Entry information : RcPrx34 (29780.m001335)
Entry ID 9362
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx34 (29780.m001335)
Name (synonym) RcPrx34 (29780.m001335)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx34
start..stop
S start..stop
RcPrx37 571 0 1..325 1..323
RcPrx36 569 0 1..325 1..326
MePrx28 565 0 1..325 1..325
MePrx71 557 0 1..325 1..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 195347..195583 237 N° 2 195065..195256 192 N° 3 194773..194938 166 N° 4 194291..194670 380
complement(join(194291..194670,194773..194938,195065..195256,195347..195583))


exon

Literature and cross-references RcPrx34 (29780.m001335)
DNA ref. Phytozome 12:   29780 (195583..194291)
Protein sequence: RcPrx34 (29780.m001335)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (293)
PWM (Da):   %s   34591.45 (31319.8)  
PI (pH):   %s   8.63 (8.73) Peptide Signal:   %s   cut: 33 range:33-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATPVPDVLVSPAKAVGVMFMLLLLMSSACQAQLTSRFYDNSCPNALSTIRTSIRNSIAAERRMAASLIRLHFHDCFVQGCDASILLDETPTIESEKTALPNKDSARGYGVIDKAKSAVEKICPGIVSCADILAVAARDASAYVGGPSWTVMLGRKDSTTASRTLANSELPSFKDGLDRLIYRFQSKGLSARDMVALSGSHTLGQAQCFTFRDRIYTNSTSIDAGFASTRRRGCPAVGGDAKLAALDLVTPNSFDNNYFKNLIQKKGLLESDQVLFSGGSTDSIVSEYSRSPAAFSSDFASAMIKMGNIINGNAGQIRKICSAV

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAACTCCGGTACCTGATGTTTTAGTATCACCCGCAAAAGCAGTAGGTGTCATGTTTATGTTACTGCTCTTGATGAGCTCAGCATGCCAGGCTCAACTCACCTCTAGATTTTATGAC
AATTCATGTCCCAATGCTCTCAGTACTATCAGGACTTCAATCAGGAACTCAATCGCAGCAGAACGAAGAATGGCAGCTTCTCTCATTCGTCTGCACTTTCACGATTGCTTTGTTCAG
GTA
TGCATACGTTAGAGTAACTATATTAAAGATCCAGTCTGCTTTTTCTCTTCAGTCAACTGATTCATGAATGCCCTTGATATTTTGCAGGGTTGTGATGCCTCTATCTTACTCGACGAGACT
CCAACGATAGAGAGTGAAAAGACTGCACTACCCAATAAGGATTCTGCCAGAGGTTACGGAGTTATAGACAAAGCAAAATCAGCAGTAGAAAAGATATGCCCTGGAATTGTATCCTGTGCA
GATATCCTAGCTGTGGCAGCAAGGGATGCTTCTGCTTAC
GTATGTGTATAAAAAATAGATTTCTAGTCCTAGAGACAATCTTCTTATATATACATATCTATTAATCTAAACAATAAATAA
TACAGCAAATGATTAATTCTTAATTTTGTCAATCACATTGTATAGGTGGGTGGTCCATCATGGACAGTGATGCTTGGAAGAAAAGACTCAACTACTGCAAGTCGAACTCTTGCCAACAGT
GAACTTCCTAGTTTTAAAGATGGCCTTGACAGACTTATTTATCGTTTTCAGAGTAAAGGCCTTAGTGCAAGGGACATGGTTGCTTTATCAG
GTTAGAATCAAACCAACATATATATCTCA
TATAAAAGCCTAGCCTTTTATAGTTTAGCAAAATCAGTCTTGCTAAGTCAGTATTTTCATTTCCATGTTGCAGGTTCACATACACTAGGTCAAGCTCAGTGCTTCACATTTCGTGATAGG
ATTTACACCAATAGCACTTCCATTGATGCTGGTTTTGCTAGCACTCGCCGCCGTGGTTGTCCAGCTGTTGGTGGTGATGCAAAATTGGCTGCGCTTGATTTAGTCACGCCCAATTCTTTT
GACAACAATTACTTCAAGAATCTGATACAAAAGAAAGGTCTTCTTGAATCAGATCAAGTTCTGTTTAGTGGAGGTTCTACAGATAGCATTGTCTCAGAATATAGCAGGAGTCCTGCAGCT
TTTAGTTCTGACTTTGCATCTGCAATGATCAAAATGGGAAATATTATCAATGGAAATGCTGGGCAGATAAGAAAGATTTGCAGTGCCGTCAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAACTCCGGTACCTGATGTTTTAGTATCACCCGCAAAAGCAGTAGGTGTCATGTTTATGTTACTGCTCTTGATGAGCTCAGCATGCCAGGCTCAACTCACCTCTAGATTTTATGAC
AATTCATGTCCCAATGCTCTCAGTACTATCAGGACTTCAATCAGGAACTCAATCGCAGCAGAACGAAGAATGGCAGCTTCTCTCATTCGTCTGCACTTTCACGATTGCTTTGTTCAG
GGT
TGTGATGCCTCTATCTTACTCGACGAGACTCCAACGATAGAGAGTGAAAAGACTGCACTACCCAATAAGGATTCTGCCAGAGGTTACGGAGTTATAGACAAAGCAAAATCAGCAGTAGAA
AAGATATGCCCTGGAATTGTATCCTGTGCAGATATCCTAGCTGTGGCAGCAAGGGATGCTTCTGCTTAC
GTGGGTGGTCCATCATGGACAGTGATGCTTGGAAGAAAAGACTCAACTACT
GCAAGTCGAACTCTTGCCAACAGTGAACTTCCTAGTTTTAAAGATGGCCTTGACAGACTTATTTATCGTTTTCAGAGTAAAGGCCTTAGTGCAAGGGACATGGTTGCTTTATCAG
GTTCA
CATACACTAGGTCAAGCTCAGTGCTTCACATTTCGTGATAGGATTTACACCAATAGCACTTCCATTGATGCTGGTTTTGCTAGCACTCGCCGCCGTGGTTGTCCAGCTGTTGGTGGTGAT
GCAAAATTGGCTGCGCTTGATTTAGTCACGCCCAATTCTTTTGACAACAATTACTTCAAGAATCTGATACAAAAGAAAGGTCTTCTTGAATCAGATCAAGTTCTGTTTAGTGGAGGTTCT
ACAGATAGCATTGTCTCAGAATATAGCAGGAGTCCTGCAGCTTTTAGTTCTGACTTTGCATCTGCAATGATCAAAATGGGAAATATTATCAATGGAAATGCTGGGCAGATAAGAAAGATT
TGCAGTGCCGTCAAC

Retrieve as FASTA