Entry information : RcPrx35 (29780.m001349)
Entry ID 9363
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx35 (29780.m001349)
Name (synonym) RcPrx35 (29780.m001349)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx35
start..stop
S start..stop
RcPrx33 618 0 1..325 1..325
RcPrx34 547 0 1..324 1..325
RcPrx36 543 0 1..324 1..326
RcPrx37 533 0 13..324 12..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 260415..260648 234 N° 2 260740..260931 192 N° 3 261052..261217 166 N° 4 261317..261699 383
join(260415..260648,260740..260931,261052..261217,261317..261699)


exon

Literature and cross-references RcPrx35 (29780.m001349)
DNA ref. Phytozome 11:   29780 (260415..261699)
Protein sequence: RcPrx35 (29780.m001349)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   325 (294)
PWM (Da):   %s   35299.13 (32032.4)  
PI (pH):   %s   10.11 (10.04) Peptide Signal:   %s   cut: 32 range:32-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MVTSASKFFLSPAKAAAIMFMLLLLNPACQAQLSSKFYDKTCPKALTTIRTSIKTAIARERRMAASLIRLHFHDCFVQGCDASILLDETSSIQSEKSALPNKDSARGYEVIDTAKSAVEKICPGVVSCADILAVAARDASAYVGGPSWTVRLGRRDSKTASRTLANRDLPSFRDGLDRLISRFRSKGLSARDMVALSGSHTLGQAQCFTFRERIYSNGTKIEAGFASTRRRRCPAIGGDANLAALDLVTPNSFDNNYFKNLIQKKGLLQSDQVLFSGGSTDSIVLEYSKNRETFNSDFATAMVKMGNLINPSRGEIRRICSAVN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTAACTTCAGCTTCCAAATTCTTTCTATCTCCAGCAAAAGCCGCAGCCATCATGTTTATGTTGCTGCTTTTGAACCCGGCATGCCAGGCCCAACTCAGCTCTAAGTTTTATGACAAA
ACATGTCCAAAGGCCCTCACTACTATCAGAACTTCCATTAAAACTGCTATTGCAAGAGAACGTAGAATGGCTGCATCTCTCATTCGCTTGCATTTTCATGATTGCTTTGTTCAG
GTACGT
ACCCCTTGTATCCCCGTTCAATTGCTACGGTCCTAAGCTTGTATATATTAATCTCATGTCGGGAACTAAATCCTGGGTCTTGCAGGGTTGTGATGCCTCCATTTTACTGGATGAGACTTC
ATCTATCCAGAGCGAGAAGTCTGCACTGCCCAATAAGGATTCTGCTAGAGGTTATGAAGTCATCGACACAGCGAAATCTGCAGTGGAGAAGATATGTCCTGGAGTTGTTTCCTGCGCTGA
TATCCTTGCTGTTGCAGCAAGAGATGCATCTGCCTAT
GTAAGTATAAATATGTGTTCTTTGAGATGCCAATTTCGACATTCGAATCTAGTGAATCAAGCTAATTAAAATGTTAATATCAA
TCATGTAAATAAATATACTTGTTTTTGTACGAATCAGGTCGGTGGTCCATCCTGGACTGTAAGGCTTGGAAGAAGGGATTCAAAGACTGCAAGTAGAACCCTAGCCAACAGGGACCTTCC
TAGTTTTAGAGATGGCCTTGACAGACTTATATCTCGCTTCCGAAGCAAAGGCCTAAGTGCTCGGGACATGGTTGCTTTATCAG
GTTGGAGCTTGGAACTATTCTAAGAGCCCGGCAGACC
TAGTTAATAGCTTATATATTTCTTGTTCATGATGCTAAAATTGTTTATTTTGCCGAATGCAGGTTCCCATACTCTAGGACAAGCTCAATGCTTTACATTTCGCGAAAGGATATACAGCAA
TGGCACTAAAATTGAAGCTGGATTCGCTAGCACTCGCAGACGCCGTTGTCCTGCTATCGGGGGCGATGCAAATTTAGCTGCACTCGATCTAGTCACACCCAATTCCTTCGACAACAATTA
CTTCAAGAATTTGATACAAAAGAAAGGTCTTCTTCAATCTGATCAAGTTCTTTTCAGCGGAGGTTCTACGGACAGCATTGTGTTGGAGTATAGCAAAAATCGTGAAACTTTCAATTCAGA
TTTCGCAACTGCCATGGTCAAGATGGGAAATCTTATCAACCCATCTCGTGGTGAAATAAGGAGAATCTGCAGTGCCGTCAACAAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGTAACTTCAGCTTCCAAATTCTTTCTATCTCCAGCAAAAGCCGCAGCCATCATGTTTATGTTGCTGCTTTTGAACCCGGCATGCCAGGCCCAACTCAGCTCTAAGTTTTATGACAAA
ACATGTCCAAAGGCCCTCACTACTATCAGAACTTCCATTAAAACTGCTATTGCAAGAGAACGTAGAATGGCTGCATCTCTCATTCGCTTGCATTTTCATGATTGCTTTGTTCAG
GGTTGT
GATGCCTCCATTTTACTGGATGAGACTTCATCTATCCAGAGCGAGAAGTCTGCACTGCCCAATAAGGATTCTGCTAGAGGTTATGAAGTCATCGACACAGCGAAATCTGCAGTGGAGAAG
ATATGTCCTGGAGTTGTTTCCTGCGCTGATATCCTTGCTGTTGCAGCAAGAGATGCATCTGCCTAT
GTCGGTGGTCCATCCTGGACTGTAAGGCTTGGAAGAAGGGATTCAAAGACTGCA
AGTAGAACCCTAGCCAACAGGGACCTTCCTAGTTTTAGAGATGGCCTTGACAGACTTATATCTCGCTTCCGAAGCAAAGGCCTAAGTGCTCGGGACATGGTTGCTTTATCAG
GTTCCCAT
ACTCTAGGACAAGCTCAATGCTTTACATTTCGCGAAAGGATATACAGCAATGGCACTAAAATTGAAGCTGGATTCGCTAGCACTCGCAGACGCCGTTGTCCTGCTATCGGGGGCGATGCA
AATTTAGCTGCACTCGATCTAGTCACACCCAATTCCTTCGACAACAATTACTTCAAGAATTTGATACAAAAGAAAGGTCTTCTTCAATCTGATCAAGTTCTTTTCAGCGGAGGTTCTACG
GACAGCATTGTGTTGGAGTATAGCAAAAATCGTGAAACTTTCAATTCAGATTTCGCAACTGCCATGGTCAAGATGGGAAATCTTATCAACCCATCTCGTGGTGAAATAAGGAGAATCTGC
AGTGCCGTCAACAAG

Retrieve as FASTA