Entry information : RcPrx36 (29780.m001350)
Entry ID 9364
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx36 (29780.m001350)
Name (synonym) RcPrx36 (29780.m001350)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx36
start..stop
S start..stop
MePrx28 584 0 1..326 1..325
MePrx58 578 0 1..326 1..328
RcPrx34 569 0 1..326 1..325
MePrx71 566 0 1..326 1..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 263354..263587 234 N° 2 263689..263880 192 N° 3 264026..264191 166 N° 4 264283..264668 386
join(263354..263587,263689..263880,264026..264191,264283..264668)


exon

Literature and cross-references RcPrx36 (29780.m001350)
DNA ref. Phytozome 11:   29780 (263354..264668)
Protein sequence: RcPrx36 (29780.m001350)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (295)
PWM (Da):   %s   34762.52 (31591.8)  
PI (pH):   %s   8.14 (7.68) Peptide Signal:   %s   cut: 32 range:32-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATSVSKILLSPAKAATFLFTLLILGTACHAQLTSTFYDSLCPNALSTIRTSIRNSIAAERRMAASLIRLHFHDCFIQGCDASVLLDETSTIESEKTALPNKDSARGYEVIDKAKTEVEKICPGVVSCADILSVAARDSSAYVGGPSWTVMLGRRDSTTASRTLANSELPSFKDGLDRLISRFQSKGLSARDMVALSGAHTLGQAQCFTFRDRIYSNGTEIDAGFASTRKRSCPAVGGDANLAPLDLVTPNSFDNNYFKNLMQRKGLLESDQILLSGGSTDSIVSGYSRSPSTFSSDFASAMIKMGNIDPLTGTAGQIRRICSAI

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAACTTCAGTTTCCAAAATCTTGTTATCTCCTGCAAAGGCAGCTACTTTCTTGTTCACGTTGCTGATTTTGGGCACTGCATGCCATGCACAACTTACCTCTACATTTTATGACAGT
TTATGTCCGAATGCACTCAGTACTATTCGAACTTCCATCAGGAATTCAATTGCTGCAGAACGAAGAATGGCTGCGTCTCTCATTCGCTTACATTTTCATGATTGCTTTATTCAG
GTAATT
AACTTGTCAACGTTGACTAACTGATGTTGGTGTCCTTTCTTAAAATTAATATATAGCTTTCAGAATTAATTCATGGATCTATAATTGACTTGCAGGGTTGTGATGCCTCTGTCCTGCTTG
ATGAGACTTCAACTATCGAGAGTGAAAAGACTGCACTACCTAACAAGGACTCTGCCAGAGGTTATGAAGTCATTGACAAAGCAAAAACTGAAGTCGAGAAGATATGTCCTGGAGTTGTAT
CTTGTGCCGATATACTCTCTGTAGCAGCAAGGGATTCATCTGCATAC
GTAAGTGCATATATATATATATATATACACATAATCTCTTCTTCAAGTACCATTCTTCTGAAATATTACTTAA
CCTGAATCCAAATGATGACACAGAATAATTAATTGTGACATATAAAATTTCTTTTCAAAAAATTAATATCAGGTTGGAGGTCCATCATGGACAGTGATGCTTGGAAGAAGAGACTCAACT
ACTGCAAGTCGAACTCTTGCCAACAGTGAACTTCCTAGTTTTAAAGATGGCCTTGACAGACTTATTTCTCGTTTTCAGAGTAAAGGCCTTAGTGCAAGGGACATGGTTGCTTTATCAG
GT
CGGAACCTACCAAAACTTAATCCATTATTAGTAAATCACTGGCTTGCATACGTAAATACATGCTAATAGTGTTTCTTTCCAAGTTGCAGGTGCTCATACATTAGGTCAAGCTCAATGCTT
TACCTTCCGCGATAGAATATACAGCAATGGCACTGAGATTGATGCTGGGTTTGCTAGCACCCGCAAGCGTAGTTGTCCAGCTGTTGGTGGCGATGCAAATTTGGCTCCACTTGATTTGGT
CACCCCCAATTCTTTTGACAATAATTACTTCAAGAACTTGATGCAAAGAAAAGGTCTTCTTGAATCAGATCAAATTCTTTTGAGTGGAGGTTCTACAGACAGCATAGTCTCAGGATATAG
CAGGAGTCCTTCTACTTTCAGCTCCGATTTTGCATCTGCCATGATCAAAATGGGAAATATTGATCCTCTTACGGGAACTGCTGGTCAAATAAGGAGAATCTGCAGCGCTATAAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAACTTCAGTTTCCAAAATCTTGTTATCTCCTGCAAAGGCAGCTACTTTCTTGTTCACGTTGCTGATTTTGGGCACTGCATGCCATGCACAACTTACCTCTACATTTTATGACAGT
TTATGTCCGAATGCACTCAGTACTATTCGAACTTCCATCAGGAATTCAATTGCTGCAGAACGAAGAATGGCTGCGTCTCTCATTCGCTTACATTTTCATGATTGCTTTATTCAG
GGTTGT
GATGCCTCTGTCCTGCTTGATGAGACTTCAACTATCGAGAGTGAAAAGACTGCACTACCTAACAAGGACTCTGCCAGAGGTTATGAAGTCATTGACAAAGCAAAAACTGAAGTCGAGAAG
ATATGTCCTGGAGTTGTATCTTGTGCCGATATACTCTCTGTAGCAGCAAGGGATTCATCTGCATAC
GTTGGAGGTCCATCATGGACAGTGATGCTTGGAAGAAGAGACTCAACTACTGCA
AGTCGAACTCTTGCCAACAGTGAACTTCCTAGTTTTAAAGATGGCCTTGACAGACTTATTTCTCGTTTTCAGAGTAAAGGCCTTAGTGCAAGGGACATGGTTGCTTTATCAG
GTGCTCAT
ACATTAGGTCAAGCTCAATGCTTTACCTTCCGCGATAGAATATACAGCAATGGCACTGAGATTGATGCTGGGTTTGCTAGCACCCGCAAGCGTAGTTGTCCAGCTGTTGGTGGCGATGCA
AATTTGGCTCCACTTGATTTGGTCACCCCCAATTCTTTTGACAATAATTACTTCAAGAACTTGATGCAAAGAAAAGGTCTTCTTGAATCAGATCAAATTCTTTTGAGTGGAGGTTCTACA
GACAGCATAGTCTCAGGATATAGCAGGAGTCCTTCTACTTTCAGCTCCGATTTTGCATCTGCCATGATCAAAATGGGAAATATTGATCCTCTTACGGGAACTGCTGGTCAAATAAGGAGA
ATCTGCAGCGCTATAAAT

Retrieve as FASTA