Entry information : RcPrx37 (29780.m001351)
Entry ID 9365
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx37 (29780.m001351)
Name (synonym) RcPrx37 (29780.m001351)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx37
start..stop
S start..stop
RcPrx34 571 0 1..323 1..325
RcPrx36 551 0 12..323 13..326
MePrx71 548 0 1..323 1..325
MePrx28 548 0 12..323 13..325
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 266872..267102 231 N° 2 267192..267383 192 N° 3 267470..267635 166 N° 4 267746..268125 380
join(266872..267102,267192..267383,267470..267635,267746..268125)


exon

Literature and cross-references RcPrx37 (29780.m001351)
DNA ref. Phytozome 12:   29780 (266872..268125)
Protein sequence: RcPrx37 (29780.m001351)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (293)
PWM (Da):   %s   34411.34 (31219.7)  
PI (pH):   %s   7.92 (7.98) Peptide Signal:   %s   cut: 31 range:31-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MELPVPSNTLASKAAAFLFMFLLVNIACQAQLTSTFYANSCPNALSTIRTSIRNSIAADRRMAASLIRLHFHDCFVQGCDASILLDETPTIDSEKNALPNKDSARGYGVIGKAKSEVEKICPGVVSCADILAVAARDASAYVGGPSWTVMLGRKDSTTASRTLANTELPSFKDGLDRLISSFQIKGLSARDMVALSGAHTLGQAQCFTFRDRIYSNGPDIDAGFASTRRRGCPAIGDDANLAALDLVTPNSFDNNYFKNLIQKKGLLESDQILFSGGSTDSIVLEYSRSPATFNSDFASAMIKMGNILNANAGQIRKICSAV

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCTACCAGTTCCCAGTAATACTTTAGCATCTAAAGCAGCGGCTTTCTTGTTTATGTTTCTGCTTGTAAACATAGCATGCCAAGCTCAACTTACCTCCACGTTTTACGCCAATTCC
TGTCCAAATGCTCTTAGTACTATCAGAACTTCCATCAGGAATTCAATTGCAGCAGATCGGAGAATGGCAGCTTCTCTCATCCGTCTTCACTTTCACGATTGCTTCGTTCAG
GTACTTCAG
TGTACCTTTGATATCACATACCCTGATCTGTATATCAAGGTATGAGCATTGCTTCATAACTGTTTTTCTTGATTTTGCAGGGTTGTGATGCCTCTATCTTACTCGACGAGACTCCAACTA
TAGACAGTGAAAAGAATGCATTACCCAATAAGGATTCTGCCAGAGGCTACGGAGTAATAGGCAAAGCAAAATCTGAAGTAGAGAAGATATGCCCAGGAGTTGTATCTTGTGCAGATATAC
TAGCTGTGGCAGCAAGGGATGCTTCTGCTTAT
GTAAGTGTATATATATATATATTCTCATACCAATTAATCAACATATAAGTAATACCAGAGGTTTAATTGTTTTACACATTGTGTAGGT
GGGTGGTCCATCATGGACAGTGATGCTTGGAAGAAAAGACTCAACTACTGCAAGTCGAACTTTAGCGAACACTGAACTTCCTAGTTTTAAAGATGGCCTCGACAGACTTATTTCTAGCTT
TCAAATCAAAGGCCTTAGTGCAAGGGATATGGTTGCTTTGTCGG
GTTAGAACCATCATATTCATCAAATGAGCCTTTTTAGTTTCATTAGCAATTTAATTAAAACATTCTCGAGATATGT
AAATAATAAAAAGAATTTTCATTTACAAATGCAGGTGCTCATACACTTGGTCAAGCTCAATGCTTTACATTCCGCGATAGGATTTACAGCAATGGACCTGATATTGATGCTGGATTTGCT
AGCACTCGCCGCCGTGGTTGTCCAGCTATTGGGGATGATGCAAATTTGGCTGCGCTTGATTTAGTCACACCCAATTCTTTTGACAACAATTACTTCAAGAATCTGATACAAAAGAAAGGT
CTTCTTGAATCCGATCAAATTCTTTTCAGTGGAGGTTCTACGGACAGCATTGTGTTGGAATATAGCAGGAGCCCTGCAACTTTCAATTCTGATTTTGCATCTGCCATGATCAAAATGGGA
AACATCCTCAACGCGAATGCAGGGCAGATAAGGAAGATTTGCAGTGCTGTTAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCTACCAGTTCCCAGTAATACTTTAGCATCTAAAGCAGCGGCTTTCTTGTTTATGTTTCTGCTTGTAAACATAGCATGCCAAGCTCAACTTACCTCCACGTTTTACGCCAATTCC
TGTCCAAATGCTCTTAGTACTATCAGAACTTCCATCAGGAATTCAATTGCAGCAGATCGGAGAATGGCAGCTTCTCTCATCCGTCTTCACTTTCACGATTGCTTCGTTCAG
GGTTGTGAT
GCCTCTATCTTACTCGACGAGACTCCAACTATAGACAGTGAAAAGAATGCATTACCCAATAAGGATTCTGCCAGAGGCTACGGAGTAATAGGCAAAGCAAAATCTGAAGTAGAGAAGATA
TGCCCAGGAGTTGTATCTTGTGCAGATATACTAGCTGTGGCAGCAAGGGATGCTTCTGCTTAT
GTGGGTGGTCCATCATGGACAGTGATGCTTGGAAGAAAAGACTCAACTACTGCAAGT
CGAACTTTAGCGAACACTGAACTTCCTAGTTTTAAAGATGGCCTCGACAGACTTATTTCTAGCTTTCAAATCAAAGGCCTTAGTGCAAGGGATATGGTTGCTTTGTCGG
GTGCTCATACA
CTTGGTCAAGCTCAATGCTTTACATTCCGCGATAGGATTTACAGCAATGGACCTGATATTGATGCTGGATTTGCTAGCACTCGCCGCCGTGGTTGTCCAGCTATTGGGGATGATGCAAAT
TTGGCTGCGCTTGATTTAGTCACACCCAATTCTTTTGACAACAATTACTTCAAGAATCTGATACAAAAGAAAGGTCTTCTTGAATCCGATCAAATTCTTTTCAGTGGAGGTTCTACGGAC
AGCATTGTGTTGGAATATAGCAGGAGCCCTGCAACTTTCAATTCTGATTTTGCATCTGCCATGATCAAAATGGGAAACATCCTCAACGCGAATGCAGGGCAGATAAGGAAGATTTGCAGT
GCTGTTAAC

Retrieve as FASTA