Entry information : RcPrx44 ( 29848.m004502)
Entry ID 9370
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2014-01-09 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-02-05 (Christophe Dunand)
Peroxidase information: RcPrx44 ( 29848.m004502)
Name (synonym) RcPrx44 ( 29848.m004502)
Class Class III peroxidase    [Orthogroup: Prx030]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx44
start..stop
S start..stop
MePrx17 541 0 1..327 3..334
PtPrx52 528 0 1..327 1..334
CsPrx39 525 0 12..327 17..333
PtPrx79 508 0 1..327 1..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 328276..328497 222 N° 2 329053..329232 180 N° 3 329325..329490 166 N° 4 329849..330261 413
join(328276..328497,329053..329232,329325..329490,329849..330261)


exon

Literature and cross-references RcPrx44 ( 29848.m004502)
DNA ref. Phytozome 12:   29848 (328160..330261)
Protein sequence: RcPrx44 ( 29848.m004502)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327
PWM (Da):   %s   35501.84 Transmb domain:   %s   i12-34o
PI (pH):   %s   5.19
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MDIKPILFSLKLIFYFVLFNLFASSSATLSFNFYAASCPSVEFMVANTVRSASSADPTIPGKLLRLLFHDCFVEGCDASVLLRGNGTERSDPANTSLGGFSVIDSAKRLLEIFCPGTVSCADIVALAARDAVAITGGPLIQIPTGRRDGRVSSSANVRPNIVDTSFTMNEMIKIFSTKGLSLDDLVTLSGAHTIGTAHCSAFSDRFHEDSKGKLKLIDSTLDSTYANELMRICPAEASSSILVNNDPETSSAFDNQYYRNLLAHKGLFQSDSVLLDDARTRRQVQDFADDEVRFFDSWSRSFLKLTSIGVKTGEEGEIRQTCSLIN

Retrieve as FASTA  
Remarks Complete sequence from genomic (3 introns). Incorrect prediction from Phytozome.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATATAAAACCTATACTATTTTCTCTAAAACTAATTTTCTATTTTGTTCTCTTTAATCTTTTTGCTTCTTCTTCTGCTACCCTCTCTTTTAACTTTTATGCAGCTTCATGCCCATCT
GTCGAATTCATGGTTGCAAATACAGTGAGATCAGCTTCCTCTGCTGATCCTACCATTCCAGGGAAGCTGCTTCGCTTGCTGTTCCATGACTGCTTCGTCGAG
GTGAGTGCATTTCTTGTC
TTTTGCAGCTTTTTTGTTCATTATGTAAAATGACCAGAACCATGGCCAAGAAAATTGCAAGATGAAATGATGGATTTCTTGAATCAAGATTTGCATCTGCTTGTTTGTAACTTGAATTCA
TTCTTGGTACAAAGTAGAAACAAATAGTTATGGATTTAAAGCGTATAGTTTTAAGAGAAGTATCTTTCTTGTTATCTTTCAAGAGAAAATTGGACTATTAAGTTTTAAGAATGCATGTAA
CCATGTAAATGCCCCCATCTTTTGTGCTAAATAAGCTCCGACTAGGGTTCAAACCCAAAACCTCACTGCCCAAGACATGAGTCTCACCATTCTCATTGCTTCTCCACATGACAGACTTTA
GCCACTAGTCTGATGGATAGAGCAATTACTTGCCTACGGACATTTAGCTCTTAACTAGGATGACCATTTTCCATATCAAGCTAAAGTTAGATCCAATGAATTAACCTGTGTAGCATAACC
GTAGATACCATAAGATTAGTGGCTTCTCTGCAATGCAAGTAGTTGTCTTGGTTGCAGGGTTGTGATGCATCTGTGCTGCTACGAGGAAATGGAACCGAGCGAAGTGATCCAGCAAACACG
TCTCTTGGAGGATTTTCAGTTATTGATTCGGCTAAAAGACTGCTGGAAATTTTCTGTCCGGGGACTGTTTCTTGCGCTGATATTGTTGCTTTAGCTGCAAGAGATGCTGTTGCTATT
GTA
AGAATTACTCTGCTGTTTCTGTTTCTCTATACTTTATTTCTTGCATGCTTCTTTTAATTGATTGTCATTCATTAACAACATGAAAACAGACTGGAGGACCCTTGATCCAGATTCCAACAG
GTAGGAGAGATGGGAGGGTTTCTTCATCTGCAAATGTCAGACCAAATATTGTAGATACAAGTTTTACTATGAATGAAATGATCAAAATTTTCTCCACTAAAGGGTTATCTCTGGATGACC
TTGTTACTTTATCAG
GTAAAATGCAACTTACATTTCTGCCCACCTTCAAATAGGTCAAATCATATTCAGTTTGAAGAACGGACAAAAGGTTTCTGGGTTTATAGTGTCCTAGCTGATAAG
AACATTATCTTGCAAGGTTAATTGACATGTTTTGGTTGTTAAAACTTTAGAACAGCTTCAGACTACATATTGCAGTAATCTCTAATAGGACTTTTTGGAGAAACATTTTCAACCTCAATC
CCAAAAAAGAAAAGCTTTTATGCACAGAAGACAGACCAATAAGAGTGTTTCTCGGGGCAGATAGAAGTTATCCCTACTAGAATTTGCATCCATCAATGGGTTGAAGCAATAACATGAAGA
TGTTCCCTTGCAGGTGCTCACACTATAGGAACAGCACACTGCAGTGCATTCAGCGACAGATTCCATGAAGACTCAAAAGGGAAGCTCAAACTCATCGACTCCACACTGGACAGTACTTAT
GCGAACGAGCTAATGAGAATATGTCCAGCAGAAGCAAGCTCATCGATATTAGTAAACAATGATCCTGAAACATCTTCTGCATTTGATAATCAGTATTACAGAAATCTCTTAGCCCACAAA
GGGCTATTCCAATCAGATTCTGTTCTTTTAGATGATGCGAGAACAAGAAGACAAGTGCAGGATTTTGCAGATGATGAAGTCAGGTTTTTTGATAGTTGGAGTCGGTCTTTTCTGAAGCTA
ACTAGCATTGGAGTTAAGACAGGAGAAGAAGGCGAAATCCGACAAACTTGTTCATTGATTAATGGG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGATATAAAACCTATACTATTTTCTCTAAAACTAATTTTCTATTTTGTTCTCTTTAATCTTTTTGCTTCTTCTTCTGCTACCCTCTCTTTTAACTTTTATGCAGCTTCATGCCCATCT
GTCGAATTCATGGTTGCAAATACAGTGAGATCAGCTTCCTCTGCTGATCCTACCATTCCAGGGAAGCTGCTTCGCTTGCTGTTCCATGACTGCTTCGTCGAG
GGTTGTGATGCATCTGTG
CTGCTACGAGGAAATGGAACCGAGCGAAGTGATCCAGCAAACACGTCTCTTGGAGGATTTTCAGTTATTGATTCGGCTAAAAGACTGCTGGAAATTTTCTGTCCGGGGACTGTTTCTTGC
GCTGATATTGTTGCTTTAGCTGCAAGAGATGCTGTTGCTATT
ACTGGAGGACCCTTGATCCAGATTCCAACAGGTAGGAGAGATGGGAGGGTTTCTTCATCTGCAAATGTCAGACCAAAT
ATTGTAGATACAAGTTTTACTATGAATGAAATGATCAAAATTTTCTCCACTAAAGGGTTATCTCTGGATGACCTTGTTACTTTATCAG
GTGCTCACACTATAGGAACAGCACACTGCAGT
GCATTCAGCGACAGATTCCATGAAGACTCAAAAGGGAAGCTCAAACTCATCGACTCCACACTGGACAGTACTTATGCGAACGAGCTAATGAGAATATGTCCAGCAGAAGCAAGCTCATCG
ATATTAGTAAACAATGATCCTGAAACATCTTCTGCATTTGATAATCAGTATTACAGAAATCTCTTAGCCCACAAAGGGCTATTCCAATCAGATTCTGTTCTTTTAGATGATGCGAGAACA
AGAAGACAAGTGCAGGATTTTGCAGATGATGAAGTCAGGTTTTTTGATAGTTGGAGTCGGTCTTTTCTGAAGCTAACTAGCATTGGAGTTAAGACAGGAGAAGAAGGCGAAATCCGACAA
ACTTGTTCATTGATTAATGGG

Retrieve as FASTA