Entry information : RcPrx48 (29889.m003322)
Entry ID 9373
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx48 (29889.m003322)
Name (synonym) RcPrx48 (29889.m003322)
Class Class III peroxidase    [Orthogroup: Prx027]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx48
start..stop
S start..stop
MePrx62 553 0 6..337 5..335
PtPrx17 553 0 6..337 5..337
GhPrx37 506 0 1..337 1..330
VvPrx19 503 0 1..337 1..333
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 417867..418115 249 N° 2 418210..418401 192 N° 3 418532..418697 166 N° 4 418798..419201 404
join(417867..418115,418210..418401,418532..418697,418798..419201)


exon

Literature and cross-references RcPrx48 (29889.m003322)
DNA ref. Phytozome 12:   29889 (417867..419201)
Protein sequence: RcPrx48 (29889.m003322)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   337 (317)
PWM (Da):   %s   36324.73 (34201.6)  
PI (pH):   %s   4.15 (4.11) Peptide Signal:   %s   cut: 21 range:21-337
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAKCLLGFCLMILVLANAFAKTPTTLNETCVDDIGFDLQFNIYQESCPEAEAIIFSWVETAISEDPRMAASLLRLHFHDCFVNGCDASVLLDDSDNFVGEKTAPPNLNSLRGFEVIDDIKSELESVCPETVSCADILATIARDTVVLSGGPSWEVQMGRKDSLSASKAAASNNIPAPNSTMATLIANFQNVGLTLDDMVALSGGHTIGKARCSTFSSRLQQGTRSSNGPDVDLDFIQSLQRLCSESESTTTLAHLDLATPATFDNQYYINLLSGEGLLPSDQALVTDDERSRGLVESYAEDPLLFFDDFKNSMLRMGSLGPLTGNSGEIRRNCRVV

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (Extra sequence at 5' end has been removed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAAGTGCTTATTAGGTTTCTGTTTAATGATACTTGTGCTCGCAAATGCATTTGCAAAAACACCAACCACCTTGAATGAAACATGTGTAGATGACATTGGTTTTGATCTCCAATTT
AACATATACCAAGAAAGCTGCCCAGAGGCAGAAGCTATCATTTTTTCTTGGGTTGAAACTGCAATCTCTGAAGACCCGAGAATGGCAGCTTCCTTGCTTCGTCTTCACTTCCATGATTGC
TTTGTTAAT
GTAAATGCTATGTATATTCCTTCTGTTTATTTAGTTCTTTCATTGTGATTGTAATGCTTGTAATTGATGTGTGCATGCATAATGAATTTCGCAGGGCTGTGATGCGTCAGT
GCTGCTAGATGACTCTGACAACTTTGTGGGTGAGAAAACTGCCCCACCCAACTTGAATTCTTTAAGAGGATTTGAAGTGATCGATGACATTAAATCCGAACTGGAATCTGTTTGTCCTGA
AACTGTGTCCTGTGCTGATATTCTTGCTACAATTGCCAGAGATACTGTTGTTCTA
GTACGTGATAGTTTAGCCACTCTTCCCATGCATTTCTCCTTCCAAGAACAATGAGCACCTCCGCT
CACGTGTAGATAAGTCATACTTTTTAAAAAAAATTGAGCTGATCTGGTATTTAATATATCTGCAGTCAGGTGGACCAAGTTGGGAAGTCCAAATGGGGAGGAAGGACAGCTTGAGTGCTA
GCAAAGCTGCAGCCTCTAATAACATCCCAGCTCCAAATTCTACAATGGCAACACTTATAGCTAATTTTCAAAATGTCGGCCTTACATTAGACGATATGGTTGCTTTGTCTG
GTATTTTCA
ACACTTGTTATTTATTAATATTTTCCTGTACCAGTTACTAACGTATGCACTGGATCTTCTACTGAGAAACATAACCATTGTAATCTGGCAGGTGGACACACTATAGGTAAAGCAAGATGC
TCAACTTTCAGCTCCAGGCTTCAACAAGGGACCCGCAGCTCTAACGGCCCTGATGTCGATTTAGATTTCATTCAGTCGCTACAGCGGTTATGTTCAGAATCTGAGAGCACCACAACACTA
GCACACCTCGACCTGGCAACACCTGCAACGTTTGACAACCAGTACTATATTAATCTTCTTTCAGGAGAGGGACTACTACCATCAGACCAGGCACTTGTGACTGACGATGAACGATCACGC
GGCCTTGTTGAATCCTACGCTGAGGATCCATTGCTGTTCTTCGATGATTTCAAGAATTCAATGCTTAGAATGGGAAGCTTAGGGCCACTGACTGGGAACAGTGGGGAGATACGTAGGAAC
TGTAGGGTTGTTAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCAAGTGCTTATTAGGTTTCTGTTTAATGATACTTGTGCTCGCAAATGCATTTGCAAAAACACCAACCACCTTGAATGAAACATGTGTAGATGACATTGGTTTTGATCTCCAATTT
AACATATACCAAGAAAGCTGCCCAGAGGCAGAAGCTATCATTTTTTCTTGGGTTGAAACTGCAATCTCTGAAGACCCGAGAATGGCAGCTTCCTTGCTTCGTCTTCACTTCCATGATTGC
TTTGTTAAT
GGCTGTGATGCGTCAGTGCTGCTAGATGACTCTGACAACTTTGTGGGTGAGAAAACTGCCCCACCCAACTTGAATTCTTTAAGAGGATTTGAAGTGATCGATGACATTAAA
TCCGAACTGGAATCTGTTTGTCCTGAAACTGTGTCCTGTGCTGATATTCTTGCTACAATTGCCAGAGATACTGTTGTTCTA
TCAGGTGGACCAAGTTGGGAAGTCCAAATGGGGAGGAAG
GACAGCTTGAGTGCTAGCAAAGCTGCAGCCTCTAATAACATCCCAGCTCCAAATTCTACAATGGCAACACTTATAGCTAATTTTCAAAATGTCGGCCTTACATTAGACGATATGGTTGCT
TTGTCTG
GTGGACACACTATAGGTAAAGCAAGATGCTCAACTTTCAGCTCCAGGCTTCAACAAGGGACCCGCAGCTCTAACGGCCCTGATGTCGATTTAGATTTCATTCAGTCGCTACAG
CGGTTATGTTCAGAATCTGAGAGCACCACAACACTAGCACACCTCGACCTGGCAACACCTGCAACGTTTGACAACCAGTACTATATTAATCTTCTTTCAGGAGAGGGACTACTACCATCA
GACCAGGCACTTGTGACTGACGATGAACGATCACGCGGCCTTGTTGAATCCTACGCTGAGGATCCATTGCTGTTCTTCGATGATTTCAAGAATTCAATGCTTAGAATGGGAAGCTTAGGG
CCACTGACTGGGAACAGTGGGGAGATACGTAGGAACTGTAGGGTTGTTAAC

Retrieve as FASTA