Entry information : RcPrx49 ( 29900.m001566)
Entry ID 9374
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2016-01-15 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-15 (Achraf Jemmat)
Peroxidase information: RcPrx49 ( 29900.m001566)
Name (synonym) RcPrx49 ( 29900.m001566)
Class Class III peroxidase    [Orthogroup: Prx029]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx49
start..stop
S start..stop
MePrx10 613 0 16..353 18..348
CsPrx13 585 0 16..352 17..354
PtPrx07 582 0 17..352 11..344
CppPrx08 581 0 18..352 18..353
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 175595..175876 282 N° 2 175245..175445 201 N° 3 172731..173312 582  
complement(join(172731..173312,175245..175445,175595..175876))


exon

Literature and cross-references RcPrx49 ( 29900.m001566)
DNA ref. Phytozome 12:   29900 (176138..172734)
Protein sequence: RcPrx49 ( 29900.m001566)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   355
PWM (Da):   %s   38886.08 Transmb domain:   %s   o13-35i
PI (pH):   %s   9.68
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MPTYSSSSSSSSSLSFVFTCLLILMLGINSSISILAKTTNTTRRPPRQLSVNYYARTCPQLEQLVGSVTSQQFKETPVSGPATIRLFFHDCFVEGCDASILISTRPGSKQLAEKDAEDNKNLRIEGFESIRKAKALVEGKCPGVVSCSDILAIAARDFVHLAGGPYYQVKKGRWDGKISLASRVTFNLPSANSTVDQLLKLFNSKGLTLQDLVVLSGAHTIGFAHCKQFVSRLYNYHGSKQPDPAIDPRLLKALKMSCPQFGGNEDIVAPFDVTTPFLFDHAYYGNLESKLGLLATDQALFLDPRTKPLVQQLGKDKQKFYQAFAQAMDKMGSIGVKRGRRHGEKRKDCSIHAS*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTACCTATTCTTCTTCTTCTTCTTCTTCTTCTTCATTATCATTTGTTTTCACTTGTTTGCTCATTTTAATGCTAGGCATAAACTCCTCAATTTCAATATTGGCGAAAACCACCAAC
ACCACCCGTCGTCCTCCTCGCCAACTTTCCGTTAATTACTATGCAAGAACCTGTCCTCAACTTGAGCAACTTGTTGGTTCAGTTACTTCCCAGCAATTTAAAGAAACACCAGTTTCAGGG
CCAGCCACCATTCGTCTATTCTTTCATGACTGCTTTGTAGAA
GTAATCATTTCAATTTCTTTACTTTGTCACGCATGCAAACTTTCACAAAAGTTGTTGCCTCACATTTTCAAGAAATGC
ACTACAAAATCCTACTGCATTTTGGCAGATATATTAGTATTAACTTACTGTTTCTGGTTTAATTGTTGAAGGGATGTGATGCATCTATACTGATATCAACAAGGCCAGGAAGCAAACAGT
TAGCAGAGAAGGACGCAGAGGATAATAAGAATTTGAGGATAGAAGGATTTGAGAGTATTAGAAAGGCTAAAGCATTGGTGGAGGGCAAGTGCCCTGGTGTTGTTTCTTGTTCAGATATTC
TTGCAATTGCAGCCAGAGATTTTGTCCACCTG
GTATGTATATGCCCTTCATTTTCTCTTATCCTTCAGCAATATCACATATATTATATTTGTGCAGTAATAACGCCTCTATCACATGCAA
TTTGTGAACCGTGAGAGCTATGACAGATGTTGAGACAATAAAAAACCCAAACTTACTGACAAAATTAAGAAATGAAGCTTTTTCTCAATACATAGTCGCTCGCCCTTTTACTTTGTGTAT
TAAGAGCAAGGGGAGGTCTATCTCATGTCCTCGTAACCTTAATTACCTATCGCATTTAGTCCTTCTATAGCCACACTTGACACTTGAGTAGCAAAACTGCCTAATAAGAAAGGAATTAAG
GGGTAATTTGTAACTCAAGGTGCCTACCCCGTTGCCAAAATAGCAAAGTGAAGAAGGGCAGTAGAGGGGTGGGAACCACTTGCTCATGTTCTAGGTGTTATTTTGGTACTATATCTCAAT
AATTGCAACAAAATAGACAATAGTCCATGTAACAGAAAGTATATCTTAATTTCCATCTCATTGTTTGTTGGTGTGAATATTTTATGCTGCTCATAATACTTCCAAAATAGAATGCACATA
CGAAGACTGTTTTTGTCATTTTTGACAAAATATATATAACTCAAACACACAGTCTTCTAAAAGGACTACCAAAGGATAAAAATCATTATTCCATGTGACTTAAATTATTTTTCGTCCTTT
TTTTTTTGCAAATGTGATTTTTAACAGCTAGGCCAGTGTGCCGGTTACTTTGTCTTTAGATTGGCGCAGCTTCAGCAAGAAAGTCAAGATCTGATCAAATTGCCCTTTAAAAGAATACTG
TAAAGTTCTAACATGATGGCCATTGAGATGCTAAATGCCTGGCGTTATTTTTTCTAGGGAATATTAAATACAGTTTAATAAAAATTTTATTTTTTTATATTAATTGATAATAATTTAAAA
AATAATAGAAAATTAACTATTTTAATTTTTTAAAATTTTATTAATGTAATAATATAAAAAATATTTTTAAAATATTTATTAATTAATATTAGTATTATATAACTTAATACTATAATTGAT
ATTATTATTTTTAAAATTAAAATTTATTATATAACTAAAAAATTAATTTATTATTAAATATAATATTAAAAATATAGTTTAAGATATTATTTTTTAGAATTAGAATTATTATCTAATTAA
AAAATAATTAATTAATTAATTAATATAAAATATAAATAATATGCTATTTTGTAGAATAAAATTAGTTTCTTCATCTGATTAAGAAATTATTTATTAGTTAATATAATATTAAAATATAAT
AAATATATTATTTTTTAGAATTAGAGTCAGTGTTTAATTAATAAATTAATAGGATAAATTATAAATTTATATATAAACTTAAATTTTATGTGTCAAAAGTAGTACACATGTCAAAACAAA
AAATTTATATGTTAAAAATTAAACACACGTATCAAAAAAAAAATTAAACTTCATAAATTAATATATATATATATAATTTTACTTCAAAATAAATATAATGTAATTCTTATTATTAGGAAT
CCAAGGAAAAAATGATTTATATCGTTAGGAAAAAATCCCTATATATCTATGCCATGTCAACTTTTCAAATGACATAAATCATATTACCACAAAAGAAAAAATCATATTCTTTTATATGAA
AACATTATATTCTTCTATATGAAAATGCGATAAACCAGAGGGATGTATTTGTATTTTCCCTTTTCTGTATGATGCTAGTACAAAAGGGAAAACAAAAACTGGCATTCTGACTTGGATTGG
TTGGTAGGTTTCCCTGTGCTAGATAATGGGTTCTTCTAGTTTCATACTTGTGCTAGTCACTGGATGATGGGTCCTGTTAGTTTGTTCTTTTTTGGGTCTAAAAGAAGCTTCCCATCAATA
ATGCAATGCTCTAATTAGATATTTGTTTACATGACATGGCACAGGCAGGGGGACCTTATTACCAAGTGAAGAAAGGCAGATGGGATGGGAAAATATCACTGGCATCAAGGGTAACCTTCA
ATCTCCCTAGTGCAAATTCAACAGTTGATCAGCTACTAAAACTCTTCAACTCCAAAGGATTGACACTCCAAGATCTAGTAGTACTTTCGGGTGCACATACAATTGGGTTTGCCCATTGTA
AGCAATTTGTTAGCCGCCTCTACAATTATCATGGCAGTAAGCAGCCTGATCCTGCCATTGACCCAAGGCTACTAAAGGCACTAAAGATGTCATGCCCACAATTTGGTGGAAATGAGGATA
TTGTAGCACCATTTGATGTTACTACTCCATTCTTGTTTGATCACGCTTATTATGGAAATCTGGAGTCTAAATTGGGCTTATTGGCCACTGACCAAGCCCTCTTTTTGGACCCAAGGACCA
AGCCCTTAGTTCAACAGTTGGGTAAAGATAAGCAAAAATTCTATCAGGCATTTGCACAGGCAATGGATAAAATGGGTTCAATTGGTGTCAAGAGGGGTAGAAGACATGGGGAGAAGAGGA
AAGATTGTAGTATTCATGCTTCATGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCCTACCTATTCTTCTTCTTCTTCTTCTTCTTCTTCATTATCATTTGTTTTCACTTGTTTGCTCATTTTAATGCTAGGCATAAACTCCTCAATTTCAATATTGGCGAAAACCACCAAC
ACCACCCGTCGTCCTCCTCGCCAACTTTCCGTTAATTACTATGCAAGAACCTGTCCTCAACTTGAGCAACTTGTTGGTTCAGTTACTTCCCAGCAATTTAAAGAAACACCAGTTTCAGGG
CCAGCCACCATTCGTCTATTCTTTCATGACTGCTTTGTAGAA
GGATGTGATGCATCTATACTGATATCAACAAGGCCAGGAAGCAAACAGTTAGCAGAGAAGGACGCAGAGGATAATAAG
AATTTGAGGATAGAAGGATTTGAGAGTATTAGAAAGGCTAAAGCATTGGTGGAGGGCAAGTGCCCTGGTGTTGTTTCTTGTTCAGATATTCTTGCAATTGCAGCCAGAGATTTTGTCCAC
CTG
GCAGGGGGACCTTATTACCAAGTGAAGAAAGGCAGATGGGATGGGAAAATATCACTGGCATCAAGGGTAACCTTCAATCTCCCTAGTGCAAATTCAACAGTTGATCAGCTACTAAAA
CTCTTCAACTCCAAAGGATTGACACTCCAAGATCTAGTAGTACTTTCGGGTGCACATACAATTGGGTTTGCCCATTGTAAGCAATTTGTTAGCCGCCTCTACAATTATCATGGCAGTAAG
CAGCCTGATCCTGCCATTGACCCAAGGCTACTAAAGGCACTAAAGATGTCATGCCCACAATTTGGTGGAAATGAGGATATTGTAGCACCATTTGATGTTACTACTCCATTCTTGTTTGAT
CACGCTTATTATGGAAATCTGGAGTCTAAATTGGGCTTATTGGCCACTGACCAAGCCCTCTTTTTGGACCCAAGGACCAAGCCCTTAGTTCAACAGTTGGGTAAAGATAAGCAAAAATTC
TATCAGGCATTTGCACAGGCAATGGATAAAATGGGTTCAATTGGTGTCAAGAGGGGTAGAAGACATGGGGAGAAGAGGAAAGATTGTAGTATTCATGCTTCATGA

Retrieve as FASTA