Entry information : RcPrx55 (30015.m000220)
Entry ID 9378
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status partial
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx55 (30015.m000220)
Name (synonym) RcPrx55 (30015.m000220)
Class Class III peroxidase     [Orthogroup: Prx010]*
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx55
start..stop
S start..stop
PbPrx12 236 1e-80 1..154 1..154
PtPrx73 238 1e-79 1..154 1..154
PtPrx73 61 0.00000000001 155..184 288..317
EtPrx05 230 2e-78 9..159 10..158
PtrePrx11 231 8e-78 1..154 15..168
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 123032..123256 225 N° 2 124323..124505 183 N° 3 124620..124674 55 N° 4 125419..125507 89
join(123032..123256,124323..124505,124620..124674,125419..125507)


exon

Literature and cross-references RcPrx55 (30015.m000220)
DNA ref. Phytozome 12:   30015 (123032..125507)
Protein sequence: RcPrx55 (30015.m000220)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   184
PWM (Da):   %s   18996.6 Transmb domain:   %s   o15-37i
PI (pH):   %s   8.38
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASFQSFSSPLAFKFQLGIISLYLVGIASAQLSPTFYATACPNALSIIKSGVTAAVSTEARMGASLLRLHFHDCFGCDASVLLDGASGEKSAPANTNSIRGFEVIDSIKTQLETSCPGVVSCADILAVAARDSVVALGGPNWNVQLGRRDSATANFAKAMVKMGNLSPLTGTNGQIRTNCRTA

Retrieve as FASTA  
Remarks Partial sequence from genomic. Long sequence in frame is missing due to 'NNNN' in DNA.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTTTTCAATCTTTCTCTTCACCACTTGCATTCAAATTTCAATTAGGAATAATATCTTTGTATCTTGTTGGAATAGCTTCTGCTCAGCTATCTCCTACTTTCTATGCAACAGCA
TGCCCTAATGCCCTTTCCATCATTAAGTCAGGTGTGACTGCTGCAGTGTCTACTGAGGCTCGCATGGGGGCATCCTTGCTTCGTCTTCATTTCCATGATTGCTTT
GTTAATGCAAGTCAT
TTTACTTCCTAACTTAATTTGTTCATTTATTTTTTTCCTTTTTTAGCTACATTGCTCATATAAAACATTAGCAGGCCAGTAAGTTATTATTAAATATCTAATATTATAAGGTTTTATGTT
TGAATTTTATAGTCAAAACTCAATTGAGATACCACCTATATTCGTAAAATTTTTCTTTTACAAGTACACCAGCTATAAGCCAGCTCCAATTATATGCATGTTATAAAGCTAAATTATCCG
GTGACTTTAACAAGTTTTGCTTTTACAGAGTTTCTACTATATATATTCAAACATCATTCATAAAAATAAAATAAAAAACCCTACTTGGGTAGCTAGTATTAAGCTTCTTCTTTTGTTATC
AAATTAAGATCATTGTTTATAATAATCTGACTTGGATCGTACAGATTTAATGCTTAGTCTAGTATGATTAGCAAATGCCACAACCAAAATTAGGCTATATGTTTGTATCATATATAGCTG
ACGCTATTGACATGACCCTCTTTTTGATGGTACATTTGTGTCCTTAACTTACTTTTTCACTTGTCCTTTTGCATGGTTTTATCATATTCACATCAACTTTAGACCTTGATTTCAGGCCAT
GTTGCTGGGAATGAGAAATCATATTCTATAATTTGTTTAAATTTAGTATAATGCCTTCACTTTCGTACTAAATCAATAAATAATTGATACATATTCATTATTTTTAAATAATGAAATATG
AGTCAATTATTTATTGATTTAGTATATAAAATATATATATAATTGCAGTGTATACACCAAATCAAAAGAAAAATCTTCCGCTAGGATATGTATACTCTTAACATATCTTCACATAAAAAA
AAACAAAGACTCCATAATATTTGTTTTGCTTACTTGAAAATTATGGGTGAATTCCTCATCTCCTTCGCTACGAGACAGCCACCGAGAGTGCAGGGGCTATTATTAGCCTAATTATATATA
GCACCATTCTCCACATACTTAACTATGAAATAGAAAATGATTCATTCATATTAGTTTCAACTAATTAACTATATATCAAACATATGGACAGGGATGTGATGCATCGGTGTTGTTGGATGG
GGCATCAGGAGAGAAGTCAGCACCTGCTAATACTAATTCTATAAGGGGCTTTGAAGTTATTGACTCCATTAAAACTCAACTGGAAACTTCATGCCCTGGTGTCGTCTCTTGTGCTGACAT
CTTAGCCGTCGCTGCTCGAGACTCTGTTGTTGCT
GTAAGAACAACATACGATTTTCCACCTTATGATGATTGTTTTATGAAGTTTTACATATTAATTACTGGTAATTTTCGATAAATTAA
TATGCTCGAGATCATGGATTTGTTTCAGTTGGGCGGACCTAATTGGAATGTTCAGTTAGGCCGAAGAGATTCAGCCACAGCTAGTCTTAGTGCTGCTGCTACCAACTTACCTTCCCCATT
TTCTGATCTCACTGTTCTCATCTCTAATTTCTCTAGCAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCTTTTAGTGTAGATTTTGCCAAAGC
AATGGTGAAGATGGGAAACCTTAGCCCACTTACTGGCACAAATGGTCAGATCAGGACTAACTGCAGGACGGCCAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCTTTTCAATCTTTCTCTTCACCACTTGCATTCAAATTTCAATTAGGAATAATATCTTTGTATCTTGTTGGAATAGCTTCTGCTCAGCTATCTCCTACTTTCTATGCAACAGCA
TGCCCTAATGCCCTTTCCATCATTAAGTCAGGTGTGACTGCTGCAGTGTCTACTGAGGCTCGCATGGGGGCATCCTTGCTTCGTCTTCATTTCCATGATTGCTTT
GGATGTGATGCATCG
GTGTTGTTGGATGGGGCATCAGGAGAGAAGTCAGCACCTGCTAATACTAATTCTATAAGGGGCTTTGAAGTTATTGACTCCATTAAAACTCAACTGGAAACTTCATGCCCTGGTGTCGTC
TCTTGTGCTGACATCTTAGCCGTCGCTGCTCGAGACTCTGTTGTTGCT
TTGGGCGGACCTAATTGGAATGTTCAGTTAGGCCGAAGAGATTCAGCCACAGCTAATTTTGCCAAAGCAATG
GTGAAGATGGGAAACCTTAGCCCACTTACTGGCACAAATGGTCAGATCAGGACTAACTGCAGGACGGCCAAT

Retrieve as FASTA