Entry information : RcPrx60 (30072.m000928)
Entry ID 9383
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx60 (30072.m000928)
Name (synonym) RcPrx60 (30072.m000928)
Class Class III peroxidase    [Orthogroup: Prx019]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx60
start..stop
S start..stop
MePrx102 509 0 1..315 1..319
PtPrx38 489 1e-175 4..321 2..316
CpapPrx12 434 7e-153 13..320 1..316
EglPrx48 421 5e-149 19..315 21..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 22228..22425 198 N° 2 21291..22064 774  
complement(join(21291..22064,22228..22425))


exon

Literature and cross-references RcPrx60 (30072.m000928)
DNA ref. Phytozome 12:   30072 (22425..21291)
Protein sequence: RcPrx60 (30072.m000928)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (305)
PWM (Da):   %s   34930.62 (32754.4)  
PI (pH):   %s   6.88 (6.50) Peptide Signal:   %s   cut: 20 range:20-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQTKIPFLFFLFVLPLALGDLRVGFYQSTCPQAESIVFQVVQNRFKTDPSVTAALLRLHFHDCFVRGCDASILIDPTNKKQSEKQAGPNQTVRGYEIIDEIKNALEAACPSMVSCADIIALAAKDAVALAGGPNYSVPTGRRDGLVSNIGDVNLPGPQLTVPEAFQFFRPKGFTVGEMVTLLGAHTVGVAHCSFFQERVSNGAFDPTMDSNLAANLSKICASSNSDPSVFMDQSTGFVFDNEYYKQLLLKRGIMQIDQELSVDGSSAGFVSSFARNGIGFKQSFGNAMVKLGTVEVLVGNAGEVRTNCRVFNAQKKPMNPNLLF

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAAACCAAAATTCCGTTTCTGTTCTTTCTTTTTGTTCTTCCTCTTGCACTCGGTGATCTTAGGGTTGGTTTTTACCAATCAACCTGTCCCCAAGCAGAATCTATTGTATTCCAAGTT
GTGCAAAATCGGTTTAAAACTGATCCATCCGTAACTGCAGCCTTGCTTCGCTTGCATTTTCATGATTGCTTCGTCAGA
GTAAGATTTTCATATGCCAGCAACGTATCACGAACATTTCTT
AATCATATATATTACTCGATTTGACCACAAATTCTCTAATTTAGTTTTGAACTTGCAAAACAATGAGTCTTGTGTGCTGAAAATGCCTTTTGAATACTGATGCGTCTATGCTTTATGACA
GGGTTGTGATGCGTCCATTCTAATAGACCCAACAAACAAAAAACAATCTGAGAAGCAAGCAGGACCGAACCAGACGGTTCGAGGATACGAAATAATTGATGAGATCAAGAATGCATTAGA
GGCAGCCTGCCCATCAATGGTGTCCTGTGCAGACATCATTGCACTTGCAGCTAAAGATGCTGTTGCTCTAGCAGGAGGACCAAACTATAGTGTTCCAACAGGAAGACGAGACGGACTAGT
TTCAAACATAGGAGATGTTAACTTGCCAGGACCGCAATTGACTGTGCCTGAAGCATTTCAGTTTTTCAGGCCCAAAGGATTTACAGTTGGTGAAATGGTAACTCTTTTAGGTGCACATAC
AGTCGGTGTTGCTCATTGCAGTTTCTTTCAAGAACGTGTCTCAAATGGGGCTTTTGATCCTACAATGGATTCTAATCTAGCTGCCAATCTAAGCAAAATCTGTGCTTCTTCCAATTCTGA
CCCATCAGTTTTTATGGATCAAAGCACAGGTTTTGTGTTTGACAATGAGTACTATAAGCAACTATTATTGAAAAGGGGGATAATGCAGATTGATCAAGAACTTTCTGTGGATGGATCTAG
TGCAGGATTTGTCTCAAGTTTTGCAAGAAATGGGATTGGATTTAAGCAGAGTTTTGGCAATGCAATGGTGAAGTTGGGAACAGTTGAGGTTCTTGTTGGAAATGCTGGAGAAGTTAGGAC
TAATTGTAGAGTTTTCAATGCCCAAAAGAAACCAATGAACCCAAATCTATTATTT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAAACCAAAATTCCGTTTCTGTTCTTTCTTTTTGTTCTTCCTCTTGCACTCGGTGATCTTAGGGTTGGTTTTTACCAATCAACCTGTCCCCAAGCAGAATCTATTGTATTCCAAGTT
GTGCAAAATCGGTTTAAAACTGATCCATCCGTAACTGCAGCCTTGCTTCGCTTGCATTTTCATGATTGCTTCGTCAGA
GGTTGTGATGCGTCCATTCTAATAGACCCAACAAACAAAAAA
CAATCTGAGAAGCAAGCAGGACCGAACCAGACGGTTCGAGGATACGAAATAATTGATGAGATCAAGAATGCATTAGAGGCAGCCTGCCCATCAATGGTGTCCTGTGCAGACATCATTGCA
CTTGCAGCTAAAGATGCTGTTGCTCTAGCAGGAGGACCAAACTATAGTGTTCCAACAGGAAGACGAGACGGACTAGTTTCAAACATAGGAGATGTTAACTTGCCAGGACCGCAATTGACT
GTGCCTGAAGCATTTCAGTTTTTCAGGCCCAAAGGATTTACAGTTGGTGAAATGGTAACTCTTTTAGGTGCACATACAGTCGGTGTTGCTCATTGCAGTTTCTTTCAAGAACGTGTCTCA
AATGGGGCTTTTGATCCTACAATGGATTCTAATCTAGCTGCCAATCTAAGCAAAATCTGTGCTTCTTCCAATTCTGACCCATCAGTTTTTATGGATCAAAGCACAGGTTTTGTGTTTGAC
AATGAGTACTATAAGCAACTATTATTGAAAAGGGGGATAATGCAGATTGATCAAGAACTTTCTGTGGATGGATCTAGTGCAGGATTTGTCTCAAGTTTTGCAAGAAATGGGATTGGATTT
AAGCAGAGTTTTGGCAATGCAATGGTGAAGTTGGGAACAGTTGAGGTTCTTGTTGGAAATGCTGGAGAAGTTAGGACTAATTGTAGAGTTTTCAATGCCCAAAAGAAACCAATGAACCCA
AATCTATTATTT

Retrieve as FASTA