Entry information : RcPrx67 ( 30147.m014131)
Entry ID 9389
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-28 (Christophe Dunand)
Peroxidase information: RcPrx67 ( 30147.m014131)
Name (synonym) RcPrx67 ( 30147.m014131)
Class Class III peroxidase    [Orthogroup: Prx036]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx67
start..stop
S start..stop
MePrx90 579 0 1..323 1..323
PpePrx62 549 0 1..323 1..324
EgrPrx56 536 0 6..323 8..323
EglPrx56 534 0 6..323 8..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 477922..478140 219 N° 2 478324..478512 189 N° 3 478662..479222 561  
join(477922..478140,478324..478512,478662..479222)


exon

Literature and cross-references RcPrx67 ( 30147.m014131)
DNA ref. Phytozome 12:   30147 (477922..479222)
Protein sequence: RcPrx67 ( 30147.m014131)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (297)
PWM (Da):   %s   35685.98 (32990.4)  
PI (pH):   %s   8.16 (7.79) Peptide Signal:   %s   cut: 27 range:27-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATCPPKSSLLATIFLLSVLISPLKATLDAHYYDQTCPQAENIVLQTVQNASMHDPKVPAHLLRMFFHDCFIRGCDASILLDSTPGNQAEKDGPPNISVRPFYVIDDAKAKLEMVCPHTISCADIIAIAARDVVAMSGGPHWNVLKGRKDGRVSRANDTINLPAPTFNVTQLIQSFAKRSLGVKDMVALSGGHTLGFSHCSSFEARLRNFSSVHDVDPSMKSEFAEKLRKKCPKQNKDRNAGEFLDLTSSTFDNDYYKQLKEGKGVFGSDQALFSDYRTRWIVETFSRDQSLFFREFAASMVKLGNVGVIENGEVRHKCQVVS

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACTTGTCCACCAAAGTCCTCACTTTTAGCAACAATTTTCCTTCTCTCTGTCTTAATTTCACCATTGAAAGCTACGCTTGATGCTCATTACTATGATCAAACATGTCCACAAGCT
GAGAATATTGTCTTGCAGACAGTTCAGAATGCTTCCATGCATGACCCTAAAGTCCCAGCTCATCTCCTTAGAATGTTTTTCCATGATTGTTTCATAAGG
GTATGAGTATCTCTCTCTTAA
TCTAATAAACACACTTGCACGCCAACTTATGCACACATCATTATAGGTCACTCAAGAAATTGATATCCACACAATCATAAAGTGAACAAGTTTAGTCACGGATGAAAATAAGAATGCTGA
ACTAATCAAATATACGTAATCTCTCTATTTACCTATCGATAGGGATGTGATGCATCAATTTTGCTGGACTCTACTCCGGGAAACCAAGCAGAGAAAGATGGCCCTCCCAATATCTCAGTT
CGACCCTTCTATGTGATTGATGATGCCAAAGCCAAGCTTGAAATGGTTTGTCCACACACCATTTCATGTGCAGATATCATAGCTATAGCAGCAAGAGATGTGGTGGCCATG
GTAATGTAA
CATGTACTCTGCAATAACCATCACCATGTGAAAAAGGATGGTTATTCGTTGAAGATAACTTTGTTATAAAAAAAATCTAGATTCTTTTAATTTTCTCTTCTCTAAGGAATTATCATATCT
TTCTTATTACATTCCATCAGTCAGGAGGACCTCATTGGAATGTACTAAAGGGTAGGAAGGACGGAAGGGTGTCCAGAGCTAATGATACCATAAACCTACCAGCTCCAACTTTCAATGTAA
CACAACTCATTCAAAGCTTTGCGAAGAGAAGTTTAGGAGTCAAAGACATGGTTGCTTTATCAGGTGGCCACACTCTAGGTTTTTCACACTGCTCCTCATTTGAAGCTCGCCTTCGCAACT
TCAGTTCAGTGCATGACGTAGATCCAAGCATGAAGAGTGAGTTCGCAGAGAAGCTAAGAAAGAAATGCCCAAAACAAAACAAGGATCGTAATGCAGGAGAGTTCCTGGACCTGACCTCTT
CGACCTTTGATAATGACTACTACAAGCAACTCAAGGAAGGAAAAGGTGTGTTTGGATCAGATCAAGCATTGTTCAGTGATTACAGGACTAGATGGATAGTAGAAACATTTTCCAGGGATC
AAAGTTTGTTCTTTAGAGAATTTGCAGCTTCAATGGTGAAACTGGGAAATGTAGGGGTCATTGAAAATGGAGAAGTCAGACATAAATGCCAAGTGGTCAGT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTACTTGTCCACCAAAGTCCTCACTTTTAGCAACAATTTTCCTTCTCTCTGTCTTAATTTCACCATTGAAAGCTACGCTTGATGCTCATTACTATGATCAAACATGTCCACAAGCT
GAGAATATTGTCTTGCAGACAGTTCAGAATGCTTCCATGCATGACCCTAAAGTCCCAGCTCATCTCCTTAGAATGTTTTTCCATGATTGTTTCATAAGG
GGATGTGATGCATCAATTTTG
CTGGACTCTACTCCGGGAAACCAAGCAGAGAAAGATGGCCCTCCCAATATCTCAGTTCGACCCTTCTATGTGATTGATGATGCCAAAGCCAAGCTTGAAATGGTTTGTCCACACACCATT
TCATGTGCAGATATCATAGCTATAGCAGCAAGAGATGTGGTGGCCATG
TCAGGAGGACCTCATTGGAATGTACTAAAGGGTAGGAAGGACGGAAGGGTGTCCAGAGCTAATGATACCATA
AACCTACCAGCTCCAACTTTCAATGTAACACAACTCATTCAAAGCTTTGCGAAGAGAAGTTTAGGAGTCAAAGACATGGTTGCTTTATCAGGTGGCCACACTCTAGGTTTTTCACACTGC
TCCTCATTTGAAGCTCGCCTTCGCAACTTCAGTTCAGTGCATGACGTAGATCCAAGCATGAAGAGTGAGTTCGCAGAGAAGCTAAGAAAGAAATGCCCAAAACAAAACAAGGATCGTAAT
GCAGGAGAGTTCCTGGACCTGACCTCTTCGACCTTTGATAATGACTACTACAAGCAACTCAAGGAAGGAAAAGGTGTGTTTGGATCAGATCAAGCATTGTTCAGTGATTACAGGACTAGA
TGGATAGTAGAAACATTTTCCAGGGATCAAAGTTTGTTCTTTAGAGAATTTGCAGCTTCAATGGTGAAACTGGGAAATGTAGGGGTCATTGAAAATGGAGAAGTCAGACATAAATGCCAA
GTGGTCAGT

Retrieve as FASTA