Entry information : RcPrx72 (30169.m006321)
Entry ID 9394
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx72 (30169.m006321)
Name (synonym) RcPrx72 (30169.m006321)
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx72
start..stop
S start..stop
PtPrx36 502 1e-179 6..355 48..385
PpePrx50 471 3e-168 26..350 10..343
VvPrx90 468 2e-166 27..354 48..375
PpePrx04 466 6e-166 26..350 2..348
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 472829..473044 216 N° 2 473633..473830 198 N° 3 474296..474461 166 N° 4 474561..475048 488
join(472829..473044,473633..473830,474296..474461,474561..475048)


exon

Literature and cross-references RcPrx72 (30169.m006321)
DNA ref. Phytozome 12:   30169 (472829..475048)
Protein sequence: RcPrx72 (30169.m006321)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   356
PWM (Da):   %s   39501.23  
PI (pH):   %s   4.99
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEDINFSVFLQRDEIIRTYSTADIHDLEYDFYRQTCPQAESIVRSRMASIYSQHNDVSAGLLRLFFHDCFIKGCDASVFLDDSNGNSNRSIEKQAIPNRTLKGLDKIDMIKKDLENACPGVVSCADTLALATRDGVVLAGGPFYPVFTGRRDSTQSYFQEAMAEIPKPNGNISETLDLFALRGFNERETVSLLGAHNVGRIGCDFIQGRLDNFEGTGQPDPSMPSDFVNEMRLNCQDNSSIVHDEAPVPMMSREVKNPTNGLMFSQGLSTSVSSGTGFDAHYYRNLLRGRGLLFSDQQLMADENTARYVRLYSSDDGITFRKDFSRAMVRMSNLNVLTGIQGEVRTKCSLPVSSS

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (Extra sequence at 5' end has been removed).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAAGACATTAATTTCTCTGTTTTTCTACAAAGAGATGAGATTATTCGCACCTATTCTACGGCTGATATTCATGACCTTGAGTACGACTTCTATCGCCAAACATGCCCTCAAGCAGAG
TCCATTGTCAGATCAAGAATGGCTTCCATTTACTCACAGCATAATGATGTCTCTGCCGGTCTCTTGAGGCTCTTTTTCCATGATTGCTTTATCAAG
GTACATTCTTCATTTCTTTCTCGG
GGTTTCGATTCTTTTTCTTTGTCATTGTGCCTGCATGTTCTTTTCTTGAATGGGTTGTATTACTTTGTATTTATTAATCTAGCTATGGTTCGTATGAAATTGGTTTTGGTTCTTTCTTTA
GTTGTACAACAGCATTGTGTATGTTATGTTTTATAGCTTTTCTTTTCATATCTTCTTGCTTGCAATTTTGTATTTCTTGATCAGGGTGTTAATTTCTTGCTCTAGACAGCAATAATCATC
GCCCTCTCCCTTCTTGTTTTAAAGGTATTCTTGAATTCGATCCAGGTGGGATTATAATATATAATTGGCTTTTCTTTGGTTCTTGATTTGTTATGGATGTAGAGTTTGTATCATAAGTTA
GATTTTTTCAAGAATTTTATCAACTATAATTTCTAATGTTGGAAACAAAGTTGTTTCTTAATTCGATTCGGGTATAAATTCCTTTTTCTCCCGAAATGTCCGGATTTCCTCGTATCAGTT
ATATTTATATTAATGAGTTCTGTCTCATTCTTGATATTGGTGATACTTACTGATCTTAAACAATGTTTGCCTCTCTTGTATCAGGGTTGTGATGCTTCAGTCTTTTTGGATGATAGCAAT
GGCAATAGTAACCGTTCCATTGAGAAGCAAGCTATCCCCAACAGGACCTTGAAGGGTCTTGATAAAATAGACATGATCAAGAAGGACCTAGAAAATGCTTGTCCAGGAGTGGTTTCGTGC
GCTGATACTCTGGCATTGGCCACCAGAGATGGGGTTGTTCTG
GTCTGCTTTTCTTCTCCTTGGCTTTTATATAGACTAAGCTTGTCCATTCTTATGTTAAAGTTGGAATTAATTGTGTTC
AATAGTTTGCAGGGCCTAGTATGACTTTAAGAAAGGTCTAGGTTAAACCATGGTGCTGGATAAAGAAATTAACTTATTCATAAATTATCAACACACAATTTGTTCTAGTTTTTGTTACTT
ACAAAGAGTTTAGTTTGGTGTCTGGATAATGAATGTTTAATAGCAATTATAATAGGATTAATTGTATTTCGACATAAGGCCTATGCTTCGTTTTCCTTCCTTTATTTGGTTGCCTAGCAT
CCTGGAAAAGGTAACCTAGTTCTATTTAACACTAAGGAACTGGAAATACAATAGCTAAAATTAAATTGGATCAGGCAAGTTACTTTTCAGTCTCAACCTAGACCATTGTTATAAGTATTA
TGTTACATCTCTTCCTCTGTTTGGCAGGCTGGTGGTCCTTTTTATCCAGTTTTTACAGGCAGGAGAGACAGTACCCAATCCTACTTTCAGGAAGCCATGGCTGAGATTCCAAAGCCTAAT
GGGAACATCAGCGAAACACTTGATCTCTTTGCCCTCAGGGGTTTTAATGAAAGAGAAACAGTCAGCCTTCTAG
GTATTTCACTCTGCATGTTTCCCTTCATTCTTGTTATATGTTGTTGA
ACGAAATAGAGAAGTAGGCATGTGGTTCCATTAATTCCTTAATTACCTATAGGCGCGCACAATGTGGGCAGAATAGGCTGTGACTTCATTCAGGGTCGCCTGGATAACTTTGAAGGAACA
GGGCAGCCAGACCCCTCTATGCCTTCTGATTTTGTCAATGAGATGAGACTTAATTGTCAAGACAATAGCAGCATCGTTCATGATGAGGCTCCTGTTCCCATGATGTCAAGAGAAGTGAAG
AATCCGACTAACGGTTTGATGTTTTCTCAAGGATTATCAACTTCAGTCTCATCTGGAACAGGTTTTGATGCCCACTACTATCGGAACTTGCTGCGGGGTAGAGGACTTCTATTTTCTGAC
CAACAATTGATGGCTGATGAGAACACTGCAAGATATGTGAGGCTTTATTCTTCAGATGATGGAATAACCTTCAGAAAGGACTTCTCCAGAGCTATGGTGAGGATGTCGAACCTTAATGTG
CTGACTGGAATTCAAGGTGAGGTTCGAACCAAATGCTCGTTGCCCGTCAGCAGCTCCTCT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAAGACATTAATTTCTCTGTTTTTCTACAAAGAGATGAGATTATTCGCACCTATTCTACGGCTGATATTCATGACCTTGAGTACGACTTCTATCGCCAAACATGCCCTCAAGCAGAG
TCCATTGTCAGATCAAGAATGGCTTCCATTTACTCACAGCATAATGATGTCTCTGCCGGTCTCTTGAGGCTCTTTTTCCATGATTGCTTTATCAAG
GGTTGTGATGCTTCAGTCTTTTTG
GATGATAGCAATGGCAATAGTAACCGTTCCATTGAGAAGCAAGCTATCCCCAACAGGACCTTGAAGGGTCTTGATAAAATAGACATGATCAAGAAGGACCTAGAAAATGCTTGTCCAGGA
GTGGTTTCGTGCGCTGATACTCTGGCATTGGCCACCAGAGATGGGGTTGTTCTG
GCTGGTGGTCCTTTTTATCCAGTTTTTACAGGCAGGAGAGACAGTACCCAATCCTACTTTCAGGAA
GCCATGGCTGAGATTCCAAAGCCTAATGGGAACATCAGCGAAACACTTGATCTCTTTGCCCTCAGGGGTTTTAATGAAAGAGAAACAGTCAGCCTTCTAG
GCGCGCACAATGTGGGCAGA
ATAGGCTGTGACTTCATTCAGGGTCGCCTGGATAACTTTGAAGGAACAGGGCAGCCAGACCCCTCTATGCCTTCTGATTTTGTCAATGAGATGAGACTTAATTGTCAAGACAATAGCAGC
ATCGTTCATGATGAGGCTCCTGTTCCCATGATGTCAAGAGAAGTGAAGAATCCGACTAACGGTTTGATGTTTTCTCAAGGATTATCAACTTCAGTCTCATCTGGAACAGGTTTTGATGCC
CACTACTATCGGAACTTGCTGCGGGGTAGAGGACTTCTATTTTCTGACCAACAATTGATGGCTGATGAGAACACTGCAAGATATGTGAGGCTTTATTCTTCAGATGATGGAATAACCTTC
AGAAAGGACTTCTCCAGAGCTATGGTGAGGATGTCGAACCTTAATGTGCTGACTGGAATTCAAGGTGAGGTTCGAACCAAATGCTCGTTGCCCGTCAGCAGCTCCTCT

Retrieve as FASTA