Entry information : RcPrx74 (30170.m014275)
Entry ID 9396
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx74 (30170.m014275)
Name (synonym) RcPrx74 (30170.m014275)
Class Class III peroxidase    [Orthogroup: Prx015]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx74
start..stop
S start..stop
MePrx114 578 0 13..318 16..320
CsPrx27 555 0 1..318 1..317
CpapPrx26 550 0 4..317 9..321
CclPrx51 549 0 1..318 1..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3688087..3688290 204 N° 2 3687792..3687980 189 N° 3 3687415..3687577 163 N° 4 3686402..3686799 398
complement(join(3686402..3686799,3687415..3687577,3687792..3687980,3688087..3688 290))


exon

Literature and cross-references RcPrx74 (30170.m014275)
DNA ref. Phytozome 12:   30170 (3688290..3686402)
Protein sequence: RcPrx74 (30170.m014275)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   318 (296)
PWM (Da):   %s   33929.17 (31775.9)  
PI (pH):   %s   8.4 (8.40) Peptide Signal:   %s   cut: 25 range:23-318
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVLFALALALLVFPISSPAGALSFNYYDHTCPQLEHTVSSAVKKAMENDKTVPAALLRMHFHDCFIRGCDASVLLESKGKNTAEKDGPPNISLHAFYVIDNAKKAVEATCPGVVSCADILALAARDAVAFSGGPSWDVPKGRKDGRISKASDTRQLPGPAFNISQLQQSFSQRGLSLEDLVALSGGHTLGFSHCSSFQNRIHNFNSSLDIDPTMNPSFAASLRNVCPVHNKVKNAGATLDSSTAIFDNSYYKLLLQGNTLFSSDQALLTTPKTKALVSKFASSQENFEKAFAKSMIKMSSISGGGGQEIRLDCKIV

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGTTTTGTTTGCTCTTGCTCTTGCCCTTTTGGTTTTTCCGATTTCTTCTCCAGCGGGTGCGCTGAGCTTTAACTATTATGATCATACTTGTCCTCAGCTCGAGCATACAGTTAGC
AGTGCCGTCAAAAAAGCAATGGAGAATGATAAGACAGTTCCAGCTGCACTGCTCAGAATGCACTTCCATGACTGTTTTATTAGA
GTAATAGATTAACCATTTAAGAATATGTGCTTTATA
TTCTCTGAGTTAATGACTATGAGTTTTCGTTGTTTGGATTGTTATGTTTTTTTTCTTTTTTTTTTTCAAGGGTTGTGATGCTTCTGTGCTCTTGGAGTCAAAGGGAAAGAACACAGCAGA
GAAAGATGGACCTCCAAACATTTCATTGCATGCATTTTATGTCATTGACAATGCAAAGAAAGCTGTAGAAGCTACATGTCCTGGTGTGGTCTCTTGTGCTGATATTTTGGCTCTAGCTGC
AAGGGACGCAGTAGCATTT
GTCAGTTTTCCTTGAAATATGATGATACCATCAGAAATTAATTACAATTTTTACAGACAGACATCGACACTGCTTTAGTTTTGTTTGAATATGTTGTATTA
AAGTAGTTGCAACTGTCTGTCCTGTTCCAATTAATGATATACTATACTAGTATACCACATATTATATATTTTATTTTACGACAGTCGTGTAATATTTGTGGCTGCCTACGCAGTCTGGAG
GACCCAGTTGGGACGTGCCTAAAGGAAGAAAAGATGGAAGGATTTCAAAAGCAAGCGACACAAGGCAATTGCCAGGTCCCGCCTTCAACATTTCTCAGTTACAGCAAAGCTTCTCCCAAA
GAGGACTTTCCCTCGAAGATCTTGTGGCTCTCTCAG
GTAATTAAAATATACATGCTTACAAATTAAATACAATATATAAAAAATCTAATTACAAATCAGATAATGAACTTTACACTTTTA
ACAATTTTATTCAATTGTTTTAAAATTTTAAAATAAATATTTATTAGCTTAATTTATTTTCAAAAATATTCTTCAATGACTATTATTGAAAATTTTAAGATAAAAAAATGATTTGAGAAG
TCGATTAAGCTTGCTAAAAGAACAATAATTATGAATAAATAAAAATAATTTATCATAGAATTAATAATATGACCATTAAAAATCTCGCATATGTGCATTCTTTCACATATTTTACATCTA
AAAGTAACAAATTTGTTAATGACTCACTAATTTTAATATTAATAAGCTGAATTAATTTGCAATATTATTTTTTAATTGTAAAACTTCAAAAATTGTTATTGAAAAATATTTTTAAAAATA
AATTTAAAGTATAAGTAATTATTTTGAAATTTTAAGACAATTGGATAAAATCATTAAGGAATATAAAATTCATAATTTAATTAGTAATTAGGCCTATATAAAAGCATACACAAAGTATAA
TATCAAAGTATAGTATCAACGTGGTTGAATATTTTTTATGGTGAATTGTAGGGGGTCATACTCTTGGATTCTCCCACTGTTCTTCATTCCAGAACAGAATACACAACTTCAATTCAAGTC
TGGACATCGATCCAACGATGAACCCATCTTTTGCGGCCAGTTTAAGGAATGTATGCCCAGTGCACAACAAGGTTAAAAATGCAGGTGCTACATTAGATTCTTCAACAGCCATTTTTGATA
ATTCATACTACAAACTACTTCTCCAAGGCAACACCCTTTTCTCATCCGACCAGGCCTTACTCACTACACCAAAAACCAAGGCATTGGTTTCCAAATTTGCTAGTTCCCAAGAAAATTTCG
AAAAGGCCTTCGCCAAGTCCATGATCAAGATGAGTAGCATCAGTGGCGGCGGTGGGCAAGAGATTAGGCTAGACTGTAAAATAGTTAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGTTTTGTTTGCTCTTGCTCTTGCCCTTTTGGTTTTTCCGATTTCTTCTCCAGCGGGTGCGCTGAGCTTTAACTATTATGATCATACTTGTCCTCAGCTCGAGCATACAGTTAGC
AGTGCCGTCAAAAAAGCAATGGAGAATGATAAGACAGTTCCAGCTGCACTGCTCAGAATGCACTTCCATGACTGTTTTATTAGA
GGTTGTGATGCTTCTGTGCTCTTGGAGTCAAAGGGA
AAGAACACAGCAGAGAAAGATGGACCTCCAAACATTTCATTGCATGCATTTTATGTCATTGACAATGCAAAGAAAGCTGTAGAAGCTACATGTCCTGGTGTGGTCTCTTGTGCTGATATT
TTGGCTCTAGCTGCAAGGGACGCAGTAGCATTT
TCTGGAGGACCCAGTTGGGACGTGCCTAAAGGAAGAAAAGATGGAAGGATTTCAAAAGCAAGCGACACAAGGCAATTGCCAGGTCCC
GCCTTCAACATTTCTCAGTTACAGCAAAGCTTCTCCCAAAGAGGACTTTCCCTCGAAGATCTTGTGGCTCTCTCAG
GGGGTCATACTCTTGGATTCTCCCACTGTTCTTCATTCCAGAAC
AGAATACACAACTTCAATTCAAGTCTGGACATCGATCCAACGATGAACCCATCTTTTGCGGCCAGTTTAAGGAATGTATGCCCAGTGCACAACAAGGTTAAAAATGCAGGTGCTACATTA
GATTCTTCAACAGCCATTTTTGATAATTCATACTACAAACTACTTCTCCAAGGCAACACCCTTTTCTCATCCGACCAGGCCTTACTCACTACACCAAAAACCAAGGCATTGGTTTCCAAA
TTTGCTAGTTCCCAAGAAAATTTCGAAAAGGCCTTCGCCAAGTCCATGATCAAGATGAGTAGCATCAGTGGCGGCGGTGGGCAAGAGATTAGGCTAGACTGTAAAATAGTTAAT

Retrieve as FASTA