Entry information : RcPrx77 (30190.m011143)
Entry ID 9399
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx77 (30190.m011143)
Name (synonym) RcPrx77 (30190.m011143)
Class Class III peroxidase    [Orthogroup: Prx012]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx77
start..stop
S start..stop
MePrx109 545 0 1..323 1..321
RcPrx85 518 0 10..323 7..320
VvPrx45 507 0 10..323 18..331
PtPrx24 501 0 1..323 1..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2164000..2164218 219 N° 2 2164328..2164519 192 N° 3 2164649..2164814 166 N° 4 2164901..2165292 392
join(2164000..2164218,2164328..2164519,2164649..2164814,2164901..2165292)


exon

Literature and cross-references RcPrx77 (30190.m011143)
DNA ref. Phytozome 11:   30190 (2164000..2165292)
Protein sequence: RcPrx77 (30190.m011143)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (297)
PWM (Da):   %s   34857.31 (31832.8)  
PI (pH):   %s   8.22 (7.98) Peptide Signal:   %s   cut: 27 range:27-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAHHLFFNRMVLTIFLIVLSSMQSHAQLSSNFYDNTCPNALSTIRTAIRSAVSRERRMSASLVRLHFHDCFVQGCDGSILLDDTSSMTGEKFARNNNNSVRGFQVIDNAKAQVESICPGIVSCADIVAVAARDASVAVGGPSWTVKLGRRDSTSASQRLADANLPGFTDSLESLISLFERKGLSARDMVALSGAHTIGQARCLTFRGRIYNNASDIDAGFASTRRRQCPANNGNGDGNLAALDLVTPNSFDNNYFRNLIQKKGLLQSDQVLFSGGSTDNIVNEYSRSPSTFSSDFASAMVKMGDIEPLTGSQGEIRRLCNVV

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCATCATTTATTTTTTAATCGCATGGTTCTTACTATATTCTTAATTGTTCTCTCAAGCATGCAATCCCATGCACAACTTTCATCAAACTTCTATGATAATACATGTCCTAATGCA
TTGAGTACCATACGGACAGCCATCAGGTCTGCCGTCTCGCGTGAGCGTAGGATGTCAGCATCTCTCGTTCGCCTTCATTTCCACGATTGTTTTGTTCAG
GTATATATTGATTTCTTTATT
TATTCATATATATATAGAAGCGGCTTTATTCTTATTTCTCCAGAACTTGAACTGAAATCCTGAAGAGTATCGGTTACTTGCATTTAAGGGTTGTGATGGTTCAATCTTGCTGGACGATAC
ATCTTCAATGACTGGAGAAAAATTTGCACGCAACAATAATAATTCTGTTAGAGGATTCCAAGTCATAGACAATGCAAAGGCGCAAGTCGAAAGCATATGTCCTGGAATAGTTTCTTGCGC
TGATATCGTTGCAGTTGCAGCACGGGATGCGTCTGTTGCT
GTAAGTGATGACATTCTTGCGTTTCCTTTGTTTATTCTCTTAAGACTTCTTGCATTAGATGGCCATTATTTGCAGTATTT
CCTAAAAATAAATAACAATGGTCATTATTTTTGACTTAATATAAAACAGGTCGGTGGCCCATCATGGACAGTGAAGCTTGGGAGAAGAGACTCTACCTCTGCAAGCCAAAGACTAGCTGA
TGCAAACCTTCCTGGATTTACAGATAGTCTGGAAAGTCTAATTTCTCTATTTGAACGCAAGGGTTTAAGTGCAAGAGATATGGTTGCTCTTTCAG
GTTTCTATTAACTAATCCTACGAAG
TGGATTTCTGCTACTTATATTAGATCTGTTCAGGATGGCTAAAGAATTGTCTTGGATACAGGAGCACATACAATTGGGCAAGCTAGATGCCTGACCTTTCGTGGTAGGATTTACAATAAT
GCAAGTGATATTGATGCTGGCTTTGCAAGTACCCGAAGACGCCAATGTCCGGCTAACAACGGAAACGGAGATGGAAATCTTGCAGCACTTGATTTGGTTACACCTAATTCTTTTGATAAC
AACTACTTCAGGAATCTTATTCAAAAAAAGGGTCTTCTTCAATCAGATCAGGTACTTTTCAGCGGCGGATCTACAGATAATATTGTTAATGAATATAGCAGGAGCCCGTCAACTTTCAGT
TCTGACTTCGCTTCTGCCATGGTAAAGATGGGAGATATAGAGCCTCTAACTGGTTCTCAAGGAGAGATACGGAGGCTTTGCAATGTGGTGAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCATCATTTATTTTTTAATCGCATGGTTCTTACTATATTCTTAATTGTTCTCTCAAGCATGCAATCCCATGCACAACTTTCATCAAACTTCTATGATAATACATGTCCTAATGCA
TTGAGTACCATACGGACAGCCATCAGGTCTGCCGTCTCGCGTGAGCGTAGGATGTCAGCATCTCTCGTTCGCCTTCATTTCCACGATTGTTTTGTTCAG
GGTTGTGATGGTTCAATCTTG
CTGGACGATACATCTTCAATGACTGGAGAAAAATTTGCACGCAACAATAATAATTCTGTTAGAGGATTCCAAGTCATAGACAATGCAAAGGCGCAAGTCGAAAGCATATGTCCTGGAATA
GTTTCTTGCGCTGATATCGTTGCAGTTGCAGCACGGGATGCGTCTGTTGCT
GTCGGTGGCCCATCATGGACAGTGAAGCTTGGGAGAAGAGACTCTACCTCTGCAAGCCAAAGACTAGCT
GATGCAAACCTTCCTGGATTTACAGATAGTCTGGAAAGTCTAATTTCTCTATTTGAACGCAAGGGTTTAAGTGCAAGAGATATGGTTGCTCTTTCAG
GAGCACATACAATTGGGCAAGCT
AGATGCCTGACCTTTCGTGGTAGGATTTACAATAATGCAAGTGATATTGATGCTGGCTTTGCAAGTACCCGAAGACGCCAATGTCCGGCTAACAACGGAAACGGAGATGGAAATCTTGCA
GCACTTGATTTGGTTACACCTAATTCTTTTGATAACAACTACTTCAGGAATCTTATTCAAAAAAAGGGTCTTCTTCAATCAGATCAGGTACTTTTCAGCGGCGGATCTACAGATAATATT
GTTAATGAATATAGCAGGAGCCCGTCAACTTTCAGTTCTGACTTCGCTTCTGCCATGGTAAAGATGGGAGATATAGAGCCTCTAACTGGTTCTCAAGGAGAGATACGGAGGCTTTGCAAT
GTGGTGAAC

Retrieve as FASTA