Entry information : RcPrx78 (30190.m011144)
Entry ID 9400
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx78 (30190.m011144)
Name (synonym) RcPrx78 (30190.m011144)
Class Class III peroxidase    [Orthogroup: Prx198]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx78
start..stop
S start..stop
RcPrx82 615 0 1..327 1..324
RcPrx79 441 3e-157 1..327 1..323
MePrx29 387 6e-136 9..327 10..325
MePrx116 370 6e-129 1..327 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2166900..2167124 225 N° 2 2166593..2166789 197 N° 3 2166317..2166480 164 N° 4 2165747..2166141 395
complement(join(2165747..2166141,2166317..2166480,2166593..2166789,2166900..2167 124))


exon

Literature and cross-references RcPrx78 (30190.m011144)
DNA ref. Phytozome 11:   30190 (2167124..2165747)
Protein sequence: RcPrx78 (30190.m011144)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (300)
PWM (Da):   %s   35153.19 (32264.8)  
PI (pH):   %s   4.53 (4.53) Peptide Signal:   %s   cut: 28 range:28-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTSNSSSGFMIFTVFLIISPCLLPCQAQLSDESFYDETCPRALSIIRGRISAAVASELRMAASLIRLHFHDCFVQGCDASILLNDAQGERSSISNANSVRGFEVIEAIKAELEEQCAQTVSCADIVAVAAGDASVAESNFHGPTWPVKLGRLDSPTAAPVADADANLPRFDNTLPQLITFFSRKGFNERELVALGAHTFGRAKCFFFRDRVNGNGNDIDAGFARTIVDTVPCPGDGSGDDNLGNLDFFTPETWDNRYFMNLIENRGLLASDQALHSGGSTDSIVEEYAINGARFRSDFAAAMIKMGDLPPPNGLQGQIRRVCSVP

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTTCTAATTCATCTTCTGGTTTCATGATTTTCACAGTATTTCTTATTATTTCCCCTTGCTTATTGCCGTGTCAAGCACAGCTTTCTGATGAAAGCTTCTATGACGAGACTTGTCCT
CGTGCCCTGAGCATTATAAGGGGACGTATTAGTGCAGCCGTTGCGAGTGAACTCAGAATGGCTGCTTCGCTCATTCGCCTTCATTTCCATGATTGCTTTGTCCAG
GTTAATATACTTTAT
AAATCTATATATTTATAATTACTGTGTGTGCATGCAAAAGGGAGATTGTAATCTTAAAGATTAAAATCTATTAATTGTAAATTATCGCATTTCAGGGTTGTGATGCATCAATCCTGTTGA
ATGATGCACAAGGCGAAAGGAGTTCAATCAGTAATGCCAACTCCGTCAGAGGATTTGAAGTCATTGAGGCTATCAAGGCTGAATTAGAGGAGCAATGTGCCCAAACTGTTTCATGTGCTG
ACATAGTTGCAGTAGCAGCTGGTGATGCATCCGTTGCTGAAAGTAACTTTCA
GTTAGTAATCTTCAAATCCTTTTTAGCAGTATGTGCTGCTTTTATTAGCTGACAATGCGCAATCTAAA
TGTAAATATTTCGTAATATGATCTCTTCATACATAACAGGTTAGTGGACCGACTTGGCCAGTGAAGCTTGGAAGATTAGACTCTCCTACAGCTGCACCCGTAGCTGATGCCGATGCCAAC
CTTCCCCGCTTTGATAATACTCTCCCCCAACTGATAACATTCTTCAGTCGCAAGGGATTTAATGAAAGAGAATTGGTTGCCCTTTCAG
GTATGTACTTGAATAACTCTTAATCTGTTTCT
TCTTTGGGATTAATTTCTACTATATGAATTACATAAACTTCGAGATTGTCTCCAAAGACTCTAATTACAAGTTCGAACTTCAATTCTACCCAAAGACCATAAAAGGCTAAAGTCTTCGTT
AATTAATTGGGATTTATATGCAGGAGCGCATACATTTGGACGAGCAAAATGCTTTTTCTTCCGTGACAGGGTCAACGGCAATGGAAATGATATTGATGCTGGATTTGCCAGAACTATAGT
GGACACAGTTCCTTGTCCTGGTGATGGGTCAGGGGATGACAACCTTGGAAACCTCGACTTTTTCACTCCTGAAACTTGGGATAACAGGTACTTCATGAATCTTATTGAAAATAGAGGCCT
TCTTGCATCAGACCAGGCACTTCACAGCGGCGGATCCACTGACAGCATCGTTGAAGAGTATGCCATTAACGGAGCAAGGTTCAGGTCTGATTTTGCAGCTGCCATGATAAAGATGGGAGA
TTTACCCCCTCCAAATGGTTTGCAAGGCCAGATACGAAGGGTCTGCAGTGTTCCTAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTTCTAATTCATCTTCTGGTTTCATGATTTTCACAGTATTTCTTATTATTTCCCCTTGCTTATTGCCGTGTCAAGCACAGCTTTCTGATGAAAGCTTCTATGACGAGACTTGTCCT
CGTGCCCTGAGCATTATAAGGGGACGTATTAGTGCAGCCGTTGCGAGTGAACTCAGAATGGCTGCTTCGCTCATTCGCCTTCATTTCCATGATTGCTTTGTCCAG
GGTTGTGATGCATCA
ATCCTGTTGAATGATGCACAAGGCGAAAGGAGTTCAATCAGTAATGCCAACTCCGTCAGAGGATTTGAAGTCATTGAGGCTATCAAGGCTGAATTAGAGGAGCAATGTGCCCAAACTGTT
TCATGTGCTGACATAGTTGCAGTAGCAGCTGGTGATGCATCCGTTGCTGAAAGTAACTTTCA
TGGACCGACTTGGCCAGTGAAGCTTGGAAGATTAGACTCTCCTACAGCTGCACCCGTA
GCTGATGCCGATGCCAACCTTCCCCGCTTTGATAATACTCTCCCCCAACTGATAACATTCTTCAGTCGCAAGGGATTTAATGAAAGAGAATTGGTTGCCCTTTCAG
GAGCGCATACATTT
GGACGAGCAAAATGCTTTTTCTTCCGTGACAGGGTCAACGGCAATGGAAATGATATTGATGCTGGATTTGCCAGAACTATAGTGGACACAGTTCCTTGTCCTGGTGATGGGTCAGGGGAT
GACAACCTTGGAAACCTCGACTTTTTCACTCCTGAAACTTGGGATAACAGGTACTTCATGAATCTTATTGAAAATAGAGGCCTTCTTGCATCAGACCAGGCACTTCACAGCGGCGGATCC
ACTGACAGCATCGTTGAAGAGTATGCCATTAACGGAGCAAGGTTCAGGTCTGATTTTGCAGCTGCCATGATAAAGATGGGAGATTTACCCCCTCCAAATGGTTTGCAAGGCCAGATACGA
AGGGTCTGCAGTGTTCCTAAT

Retrieve as FASTA