Entry information : RcPrx79 (30190.m011145)
Entry ID 9401
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx79 (30190.m011145)
Name (synonym) RcPrx79 (30190.m011145)
Class Class III peroxidase    [Orthogroup: Prx198]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx79
start..stop
S start..stop
RcPrx82 480 1e-172 1..323 1..324
RcPrx78 479 4e-172 10..323 10..327
MePrx29 389 8e-137 1..323 1..325
RcPrx85 377 6e-132 1..323 1..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2169482..2169700 219 N° 2 2169794..2169976 183 N° 3 2170140..2170308 169 N° 4 2170484..2170881 398
join(2169482..2169700,2169794..2169976,2170140..2170308,2170484..2170881)


exon

Literature and cross-references RcPrx79 (30190.m011145)
DNA ref. Phytozome 11:   30190 (2169482..2170881)
Protein sequence: RcPrx79 (30190.m011145)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (298)
PWM (Da):   %s   34918.19 (32202.9)  
PI (pH):   %s   5.03 (4.90) Peptide Signal:   %s   cut: 26 range:26-323
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MACRLSVTCLVFAISLMTCLWACQAQLSDESFYNQRCPTALSIIRGGISAAVARELRMAASLIRLHFHDCFVGGCDASILLDDPQGERSSISNANSVRGFEVIEAIKADLERQCPQTVSCADIVAVAARDASVAVSGPTWSVKLGRLDSPTAATAAQADANLPRFDNTLAQLRGFFNPKGFSDREMVALSGAHTFGRAKCFFYRNRVNGNGNNIDAGFARLIRDTVPCPADGSGDENLGDLDALTPETWDNRYFRNLIERKGLLQSDQELYSGGSTNSIVEEYDRDVSIFRSDFASAMVKMADLNPITDPNVGQIRRICSAA

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGTCGTTTATCCGTTACTTGTTTGGTTTTCGCAATATCATTAATGACTTGCTTATGGGCATGTCAAGCACAGCTTTCTGATGAAAGCTTCTATAACCAGAGATGTCCTACTGCC
CTGAGCATTATAAGGGGAGGTATTAGTGCAGCTGTTGCGCGTGAGCTGAGAATGGCTGCTTCGCTTATTCGCCTGCATTTCCATGATTGCTTTGTTGGG
GTAAACACGCTATTTATATGT
GCACATAACACAAAGACTCTATTTAATATATGCTGACTGCTAATTAGTTATAATTATGAACTCGAATTTCAGGGTTGTGATGCCTCAATCTTGCTGGATGATCCACAAGGCGAGAGGAGT
TCAATCAGTAATGCCAACTCTGTCAGGGGATTTGAAGTAATTGAGGCTATCAAGGCTGACCTTGAGAGACAATGTCCGCAGACTGTTTCATGTGCTGATATAGTTGCAGTAGCAGCTCGC
GATGCATCTGTTGCT
GTAAGTAACCTTCATTGAGTAAATAATGATCAAATCTTTATGATTATCGACAAGAAGTTAGTTTTCTTAGCTGACAATATTAATAGTAATAATAGTAGCATGAGC
GATCTAAATATTATTTTAATATATATATATGATCTTTTCATATATATGTACAAATCAGGTTAGTGGACCAACATGGTCAGTAAAGCTTGGAAGATTGGACTCCCCCACTGCTGCAACTGC
AGCCCAAGCTGATGCCAATCTTCCTCGATTTGATAATACTCTCGCTCAACTTAGGGGATTCTTCAATCCCAAGGGTTTCTCAGACAGAGAAATGGTTGCCCTTTCAG
GTAATTTAAGCAT
CGATAGAAATATTATTTCCTCGGTTAATTTCTTTTTTGGTTAACTTGGCTTCTGACTAGGTTCGAAATAGAAATTTTATAGCCTGAACAGAACTCTAGTATCACTGAAACTAACCATGTG
AAGTACAGTAAGATGGCTAAATATTTCATTAATTAAATGCAGGAGCACATACATTTGGCAGAGCAAAATGTTTTTTCTACCGCAACAGGGTGAACGGCAATGGAAATAATATCGATGCTG
GATTTGCTCGTCTGATAAGAGATACAGTTCCTTGTCCAGCTGATGGCTCAGGGGACGAAAACCTTGGCGACCTTGACGCGTTGACTCCTGAAACTTGGGATAATAGATACTTCAGAAATC
TTATCGAAAGAAAGGGCCTTCTTCAATCTGACCAGGAACTTTATAGTGGTGGATCAACAAACAGCATTGTCGAAGAGTATGATAGAGATGTTTCAATCTTCAGGTCTGATTTTGCGTCTG
CCATGGTAAAGATGGCAGATTTAAACCCAATAACTGATCCTAATGTTGGGCAGATAAGAAGGATTTGCAGTGCTGCTAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTGTCGTTTATCCGTTACTTGTTTGGTTTTCGCAATATCATTAATGACTTGCTTATGGGCATGTCAAGCACAGCTTTCTGATGAAAGCTTCTATAACCAGAGATGTCCTACTGCC
CTGAGCATTATAAGGGGAGGTATTAGTGCAGCTGTTGCGCGTGAGCTGAGAATGGCTGCTTCGCTTATTCGCCTGCATTTCCATGATTGCTTTGTTGGG
GGTTGTGATGCCTCAATCTTG
CTGGATGATCCACAAGGCGAGAGGAGTTCAATCAGTAATGCCAACTCTGTCAGGGGATTTGAAGTAATTGAGGCTATCAAGGCTGACCTTGAGAGACAATGTCCGCAGACTGTTTCATGT
GCTGATATAGTTGCAGTAGCAGCTCGCGATGCATCTGTTGCT
GTTAGTGGACCAACATGGTCAGTAAAGCTTGGAAGATTGGACTCCCCCACTGCTGCAACTGCAGCCCAAGCTGATGCC
AATCTTCCTCGATTTGATAATACTCTCGCTCAACTTAGGGGATTCTTCAATCCCAAGGGTTTCTCAGACAGAGAAATGGTTGCCCTTTCAG
GAGCACATACATTTGGCAGAGCAAAATGT
TTTTTCTACCGCAACAGGGTGAACGGCAATGGAAATAATATCGATGCTGGATTTGCTCGTCTGATAAGAGATACAGTTCCTTGTCCAGCTGATGGCTCAGGGGACGAAAACCTTGGCGAC
CTTGACGCGTTGACTCCTGAAACTTGGGATAATAGATACTTCAGAAATCTTATCGAAAGAAAGGGCCTTCTTCAATCTGACCAGGAACTTTATAGTGGTGGATCAACAAACAGCATTGTC
GAAGAGTATGATAGAGATGTTTCAATCTTCAGGTCTGATTTTGCGTCTGCCATGGTAAAGATGGCAGATTTAAACCCAATAACTGATCCTAATGTTGGGCAGATAAGAAGGATTTGCAGT
GCTGCTAAC

Retrieve as FASTA