Entry information : RcPrx82 (30190.m011148)
Entry ID 9403
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx82 (30190.m011148)
Name (synonym) RcPrx82 (30190.m011148)
Class Class III peroxidase    [Orthogroup: Prx198]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx82
start..stop
S start..stop
RcPrx78 631 0 1..324 1..327
RcPrx79 454 2e-162 1..324 1..323
MePrx29 402 1e-141 2..324 3..325
MePrx116 379 9e-133 1..324 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2182488..2182712 225 N° 2 2182208..2182390 183 N° 3 2181918..2182086 169 N° 4 2181347..2181741 395
complement(join(2181347..2181741,2181918..2182086,2182208..2182390,2182488..2182 712))


exon

Literature and cross-references RcPrx82 (30190.m011148)
DNA ref. Phytozome 11:   30190 (2182712..2181347)
Protein sequence: RcPrx82 (30190.m011148)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324 (297)
PWM (Da):   %s   34837.11 (31927.7)  
PI (pH):   %s   4.63 (4.63) Peptide Signal:   %s   cut: 28 range:28-324
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTSSSSFGFMVFTIFLITSPCLLPCQAQLSDESFYDSTCPRALSIIRGRISTAVASELRMAASLIRLHFHDCFVQGCDASILLNDTQGERSSISNANSVRGFEVIEAIKAELEEQCAQTVSCADIVAVAARDASVAVSGPTWPVKLGRLDSPTAAAVADADANLPRFDNTLPQLITFFSRKGFNERELVALSGAHTFGRAKCFFFRDRVNGNGNDIDAGFARTIVDTVPCPGDGSGNDNLGDLDFFTPETWDNRYFMNLIENRGLLASDQALHSGGSTDSIVEEYAINGARFRSDFAAAMIKMGDLPPPNGLQGQIRRVCSVP

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTTCTAGTTCATCTTTTGGTTTCATGGTTTTCACCATATTTTTAATTACTTCCCCTTGCTTATTACCGTGTCAAGCACAACTTTCTGATGAAAGCTTCTATGACTCGACTTGTCCT
CGTGCCCTGAGCATTATAAGGGGACGTATTAGTACAGCTGTTGCAAGTGAACTCAGAATGGCTGCTTCGCTTATTCGCCTTCATTTCCATGATTGCTTTGTCCAG
GTTAATGCTTTATAA
ATCTATGTATTTTTGTGCATGCAAAAGGGAGATTCTAAACTTAGAGATTAAAATCTATTAATTGTAAATTATCGCATTTCAGGGTTGTGATGCATCAATCCTATTGAACGATACACAAGG
CGAAAGAAGTTCAATCAGTAATGCCAACTCCGTCAGAGGGTTTGAAGTCATTGAGGCTATCAAGGCTGAATTAGAGGAGCAATGTGCTCAAACTGTTTCATGTGCTGACATAGTTGCAGT
AGCAGCTCGTGATGCATCCGTTGCT
GTAAGTAACTTTCAGTTAGTAATCTTCAAATCCTTACTAGCAGTATGTACTGCTTTTATTAGCTGAAAATGCGCAATCTAAACGTAAATATTTCG
TAATATGATCTCTTCATACATAACAGGTTAGTGGACCGACTTGGCCAGTGAAACTTGGAAGATTAGACTCTCCTACTGCTGCAGCCGTAGCTGATGCTGATGCTAACCTTCCCCGCTTTG
ATAATACTCTCCCCCAACTGATAACATTCTTCAGTCGCAAGGGATTTAATGAAAGAGAATTGGTTGCCCTTTCAG
GTATGTACTTCAATACACTCTTAATGTGTTTCTTCTTTGGGATTA
ATTTCTACTGTATGAATTACATAAACTTCGAGATTGTCTCCAAAGACTCTAATTACGAGTTCCAACTTCAATTCTACCCAAAAGCCATAAAAGGCTAAAGACTTCGTTAATTAATTGGAA
TTTATATGCAGGAGCGCATACATTTGGACGAGCAAAATGCTTTTTCTTCCGTGACAGGGTTAACGGCAATGGAAATGATATTGATGCTGGATTTGCCAGAACTATAGTGGACACAGTTCC
TTGTCCTGGTGATGGGTCAGGGAATGACAACCTTGGAGACCTCGACTTTTTCACTCCTGAAACTTGGGATAACAGGTACTTCATGAATCTTATTGAAAATAGAGGCCTTCTTGCATCAGA
CCAGGCACTTCACAGCGGCGGATCCACTGACAGCATTGTTGAAGAGTATGCCATTAACGGAGCAAGGTTCAGGTCTGATTTTGCAGCTGCCATGATAAAGATGGGAGATTTACCCCCTCC
AAATGGTTTGCAAGGCCAGATACGAAGGGTCTGCAGTGTTCCTAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTTCTAGTTCATCTTTTGGTTTCATGGTTTTCACCATATTTTTAATTACTTCCCCTTGCTTATTACCGTGTCAAGCACAACTTTCTGATGAAAGCTTCTATGACTCGACTTGTCCT
CGTGCCCTGAGCATTATAAGGGGACGTATTAGTACAGCTGTTGCAAGTGAACTCAGAATGGCTGCTTCGCTTATTCGCCTTCATTTCCATGATTGCTTTGTCCAG
GGTTGTGATGCATCA
ATCCTATTGAACGATACACAAGGCGAAAGAAGTTCAATCAGTAATGCCAACTCCGTCAGAGGGTTTGAAGTCATTGAGGCTATCAAGGCTGAATTAGAGGAGCAATGTGCTCAAACTGTT
TCATGTGCTGACATAGTTGCAGTAGCAGCTCGTGATGCATCCGTTGCT
GTTAGTGGACCGACTTGGCCAGTGAAACTTGGAAGATTAGACTCTCCTACTGCTGCAGCCGTAGCTGATGCT
GATGCTAACCTTCCCCGCTTTGATAATACTCTCCCCCAACTGATAACATTCTTCAGTCGCAAGGGATTTAATGAAAGAGAATTGGTTGCCCTTTCAG
GAGCGCATACATTTGGACGAGCA
AAATGCTTTTTCTTCCGTGACAGGGTTAACGGCAATGGAAATGATATTGATGCTGGATTTGCCAGAACTATAGTGGACACAGTTCCTTGTCCTGGTGATGGGTCAGGGAATGACAACCTT
GGAGACCTCGACTTTTTCACTCCTGAAACTTGGGATAACAGGTACTTCATGAATCTTATTGAAAATAGAGGCCTTCTTGCATCAGACCAGGCACTTCACAGCGGCGGATCCACTGACAGC
ATTGTTGAAGAGTATGCCATTAACGGAGCAAGGTTCAGGTCTGATTTTGCAGCTGCCATGATAAAGATGGGAGATTTACCCCCTCCAAATGGTTTGCAAGGCCAGATACGAAGGGTCTGC
AGTGTTCCTAAT

Retrieve as FASTA