Entry information : RcPrx85 (30190.m011151)
Entry ID 9406
Creation 2011-06-30 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx85 (30190.m011151)
Name (synonym) RcPrx85 (30190.m011151)
Class Class III peroxidase    [Orthogroup: Prx013]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx85
start..stop
S start..stop
RcPrx77 518 0 7..320 10..323
MePrx29 496 4e-179 1..320 1..325
MePrx109 496 8e-179 1..320 1..321
VvPrx45 491 7e-177 6..320 17..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 2196011..2196220 210 N° 2 2196318..2196509 192 N° 3 2196590..2196755 166 N° 4 2197016..2197407 392
join(2196011..2196220,2196318..2196509,2196590..2196755,2197016..2197407)


exon

Literature and cross-references RcPrx85 (30190.m011151)
DNA ref. Phytozome 11:   30190 (2196011..2197407)
Protein sequence: RcPrx85 (30190.m011151)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   320 (297)
PWM (Da):   %s   33919.75 (31393.5)  
PI (pH):   %s   8.09 (7.68) Peptide Signal:   %s   cut: 24 range:24-320
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASRLSLLCMVMLMIFSSLPCKAQLSSNFYDNTCPSALSTIKGAISTAVSREQRMAASLIRLHFHDCFVQGCDGSILLDDTPTMTGEKTARNNANSVRGFDVIDNIKSQLESRCPGIVSCADIVAVAARDASVAASGPSWSVNLGRRDSTTASRSLADSNLPAFTDSLDRLTSLFGSKGLSQRDMVALSGAHTIGQAQCVTFRGRIYNNASDIDAGFAATRRSQCPAASGSGDSNLAPLDLVTPNIFDNNYFRNLIQKKGLLQSDQVLFSGGATDSIVNQYSRDSSVFSSDFASAMVKMGNISPLTGSQGQIRRVCNVV

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCCGTTTATCTCTTCTTTGCATGGTAATGTTAATGATTTTCTCAAGCTTGCCATGTAAGGCACAGCTTTCTTCAAACTTCTATGATAATACATGTCCTTCTGCCCTAAGTACT
ATAAAGGGAGCTATTAGTACAGCAGTCTCGCGCGAGCAAAGAATGGCTGCTTCGCTTATTCGCCTTCATTTCCATGATTGCTTTGTTCAG
GTAAATGAATTTACTTGTTTTAGTTGTTTC
TTCCTGCCGAGTTCTTGAGAAAGTGAAAAACTACTAGGCTAAGTTATTATTGATTTTTGTATTGCAGGGTTGTGATGGCTCAATCTTGCTGGACGATACACCAACAATGACTGGCGAGAA
AACTGCACGCAATAATGCCAATTCTGTCAGAGGATTTGATGTCATTGACAATATCAAATCCCAACTAGAGAGCAGGTGTCCTGGAATTGTTTCATGTGCAGACATTGTTGCTGTAGCAGC
TCGCGATGCTTCCGTTGCT
GTGAGTTCGCTATTATAATTTTTGTTAGCCCGAGCATGAGATGTATTTATTCATTAATATAATCTTTGCATATGAAACAGGCTAGTGGACCTTCATGGTCA
GTGAACCTTGGAAGAAGGGACTCCACCACAGCAAGCCGAAGTTTAGCTGATAGCAACCTTCCTGCCTTCACAGATAGCCTTGACAGGCTCACTTCTCTGTTCGGCAGCAAAGGTTTGAGT
CAAAGGGATATGGTTGCCCTTTCAG
GTCTGTGGCTTTAGTAGTTGACTCGTAACTTTTTTTTTTTTTTTACCAAAACAATTCAAACTTCAGACCTTTTTCAAATGGCTAAAGCTTGTGGT
CTACAAGTGCAGTTGCTATTTATTTTTATTAAATGGTTTCCAATCGTGTTTTGTTGATGGCTGTGTTCAGATAAGGACTGATGAGGCAGAACTTGTTTCCACATGTGTGTTTCTATGTTT
GTAATTACATCGAAGATGGCTGAAAGATTTGTTTGGAATTCGCAGGAGCACATACGATAGGGCAAGCACAATGTGTGACATTCCGTGGTAGGATTTACAACAACGCAAGTGATATTGATG
CTGGCTTTGCTGCAACTAGAAGAAGCCAGTGTCCAGCTGCCAGTGGCAGTGGAGACAGCAATCTAGCACCACTAGATTTGGTGACCCCCAATATTTTTGATAACAACTACTTCAGAAATC
TTATCCAAAAGAAGGGCCTTCTCCAATCAGATCAAGTACTTTTCAGCGGTGGAGCTACCGACAGTATTGTCAACCAGTATAGCAGAGATTCTTCAGTTTTCAGCTCTGATTTTGCGTCTG
CCATGGTGAAAATGGGCAATATAAGTCCCTTAACAGGTTCTCAAGGACAAATACGAAGGGTCTGCAATGTGGTTAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCCGTTTATCTCTTCTTTGCATGGTAATGTTAATGATTTTCTCAAGCTTGCCATGTAAGGCACAGCTTTCTTCAAACTTCTATGATAATACATGTCCTTCTGCCCTAAGTACT
ATAAAGGGAGCTATTAGTACAGCAGTCTCGCGCGAGCAAAGAATGGCTGCTTCGCTTATTCGCCTTCATTTCCATGATTGCTTTGTTCAG
GGTTGTGATGGCTCAATCTTGCTGGACGAT
ACACCAACAATGACTGGCGAGAAAACTGCACGCAATAATGCCAATTCTGTCAGAGGATTTGATGTCATTGACAATATCAAATCCCAACTAGAGAGCAGGTGTCCTGGAATTGTTTCATGT
GCAGACATTGTTGCTGTAGCAGCTCGCGATGCTTCCGTTGCT
GCTAGTGGACCTTCATGGTCAGTGAACCTTGGAAGAAGGGACTCCACCACAGCAAGCCGAAGTTTAGCTGATAGCAAC
CTTCCTGCCTTCACAGATAGCCTTGACAGGCTCACTTCTCTGTTCGGCAGCAAAGGTTTGAGTCAAAGGGATATGGTTGCCCTTTCAG
GAGCACATACGATAGGGCAAGCACAATGTGTG
ACATTCCGTGGTAGGATTTACAACAACGCAAGTGATATTGATGCTGGCTTTGCTGCAACTAGAAGAAGCCAGTGTCCAGCTGCCAGTGGCAGTGGAGACAGCAATCTAGCACCACTAGAT
TTGGTGACCCCCAATATTTTTGATAACAACTACTTCAGAAATCTTATCCAAAAGAAGGGCCTTCTCCAATCAGATCAAGTACTTTTCAGCGGTGGAGCTACCGACAGTATTGTCAACCAG
TATAGCAGAGATTCTTCAGTTTTCAGCTCTGATTTTGCGTCTGCCATGGTGAAAATGGGCAATATAAGTCCCTTAACAGGTTCTCAAGGACAAATACGAAGGGTCTGCAATGTGGTTAAC

Retrieve as FASTA