Entry information : RcPrx88 (29647.m002045)
Entry ID 9407
Creation 2011-07-01 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2012-01-04 (Qiang LI)
Peroxidase information: RcPrx88 (29647.m002045)
Name (synonym) RcPrx88 (29647.m002045)
Class Class III peroxidase    [Orthogroup: Prx013]
Taxonomy Eukaryota Viridiplantae Streptophyta Euphorbiaceae Ricinus
Organism Ricinus communis    [TaxId: 3988 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value RcPrx88
start..stop
S start..stop
RcPrx18 628 0 1..322 1..325
MePrx73 545 0 1..322 1..323
MePrx130 539 0 1..322 1..323
MePrx66 537 0 1..322 1..323
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 358790..358993 204 N° 2 359280..359471 192 N° 3 359555..359720 166 N° 4 359877..360280 404
join(358790..358993,359280..359471,359555..359720,359877..360280)


exon

Literature and cross-references RcPrx88 (29647.m002045)
DNA ref. Phytozome 12:   29647 (358790..360280)
Protein sequence: RcPrx88 (29647.m002045)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (302)
PWM (Da):   %s   35223.13 (33090.0) Transmb domain:   %s   i5-23o
PI (pH):   %s   8.48 (8.57) Peptide Signal:   %s   cut: 21 range:21-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKTVFLICLLVLCVIGVCQGGGLRKKFYRKSCPQAEDIVRKVTERHVLSNPNLPAKLLRMHFHDCFVRGCDGSILIESTTNNTAEKDSIPNLTLTGFDVIEDIKSELEKVCPGLVSCADILALAARDSVSYQFKKPLWEVLTGRRDGSVSLASEVFAHIPSPFANFSALKQNFKSKGLTVHDLVVLSGGHTIGVGHCNLFSNRLYNFTGKGDQDPSLSATYAEFLKAKCRSLADTTTTVEMDPDSSFTFDNDYFVILKQHKGLFQSDAALLTNKIASKIAGELLNSKAFFTEFAQSMKRMGAIEVLTGSKGEIRKKCSVVN

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (Gap in frame).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACTGTTTTTCTCATTTGCTTGTTAGTTTTGTGTGTTATTGGTGTTTGTCAAGGAGGTGGTCTGAGGAAGAAATTCTATAGAAAATCCTGTCCTCAAGCAGAAGATATTGTTAGG
AAGGTTACTGAGAGACATGTCTTAAGCAATCCCAATTTACCTGCTAAGTTGTTGAGAATGCATTTTCATGACTGCTTTGTCAGG
GTAAGACATGCACTTTATTTCATGCACATATACAAG
CCAATTCTTTTATATGTATCTCTCTCTCTCTCTATATATATATATATATAACATGGTTAATTTGCACTAGCAATAAATTATACATGAGTGGATATGGTTAATTTGCACAATCGTACCTGT
CCTAGGTAATTAGAATGCATGGACAAAATAGTTTTGTTTTTTTATGTGCATACATAAATGCTCTTTTAACTTTTTGATCTCTAATTTATTAGTGTGCATATGCGTGACGTAATGTCTAAT
TAAATTTCAGGGATGCGATGGTTCAATTTTAATAGAATCAACAACAAACAACACTGCAGAGAAAGATTCAATTCCAAACCTAACTTTGACAGGATTTGATGTTATTGAAGACATAAAATC
AGAGCTAGAGAAAGTATGTCCAGGACTTGTATCTTGTGCTGATATATTGGCCTTGGCTGCCAGGGATTCGGTTTCCTACCAG
GTATATTTAAAACCAACTATTTTCATGTTTTCCATGCA
TCGTCCATCACGCCTGATATAAAATGCATTTCCCTTTTGCCTCAGTTCAAAAAACCACTATGGGAAGTGCTTACTGGTAGAAGAGATGGCAGTGTTTCACTAGCTTCTGAAGTCTTTGCT
CATATACCTTCGCCCTTTGCCAATTTCTCTGCTCTTAAGCAAAATTTTAAAAGCAAGGGTCTTACAGTCCATGATCTAGTTGTACTGTCAG
GTAACTATTTACTCGAACAATTAGTATTT
TGAGCAATAATAATTGTGATAATATTAATTACATATCGACTCCTTCTGTTAGTTATTTTCTTTAGAAAAAAGAGAAGTTAATATGATAAAAAACTATATATATCAAAATTTCTTTGAATG
TTTGTAGGTGGACACACCATTGGAGTAGGACACTGCAATCTCTTCAGCAATAGGCTTTACAATTTCACAGGAAAAGGCGATCAAGACCCTTCCCTTAGCGCAACCTATGCGGAGTTCCTG
AAGGCCAAATGTCGAAGTCTTGCCGACACGACAACCACAGTAGAGATGGATCCTGATAGCTCTTTCACATTTGATAACGATTACTTTGTTATTCTTAAGCAGCATAAGGGTCTTTTCCAA
TCTGATGCAGCCCTTCTAACGAACAAGATTGCCAGTAAAATTGCTGGAGAGTTGCTTAATTCTAAAGCTTTCTTTACAGAGTTTGCTCAGTCAATGAAGAGGATGGGAGCCATTGAAGTT
CTTACTGGCTCTAAAGGAGAGATCAGGAAAAAGTGCAGTGTTGTTAATTCT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGACTGTTTTTCTCATTTGCTTGTTAGTTTTGTGTGTTATTGGTGTTTGTCAAGGAGGTGGTCTGAGGAAGAAATTCTATAGAAAATCCTGTCCTCAAGCAGAAGATATTGTTAGG
AAGGTTACTGAGAGACATGTCTTAAGCAATCCCAATTTACCTGCTAAGTTGTTGAGAATGCATTTTCATGACTGCTTTGTCAGG
GGATGCGATGGTTCAATTTTAATAGAATCAACAACA
AACAACACTGCAGAGAAAGATTCAATTCCAAACCTAACTTTGACAGGATTTGATGTTATTGAAGACATAAAATCAGAGCTAGAGAAAGTATGTCCAGGACTTGTATCTTGTGCTGATATA
TTGGCCTTGGCTGCCAGGGATTCGGTTTCCTACCAG
TTCAAAAAACCACTATGGGAAGTGCTTACTGGTAGAAGAGATGGCAGTGTTTCACTAGCTTCTGAAGTCTTTGCTCATATACCT
TCGCCCTTTGCCAATTTCTCTGCTCTTAAGCAAAATTTTAAAAGCAAGGGTCTTACAGTCCATGATCTAGTTGTACTGTCAG
GTGGACACACCATTGGAGTAGGACACTGCAATCTCTTC
AGCAATAGGCTTTACAATTTCACAGGAAAAGGCGATCAAGACCCTTCCCTTAGCGCAACCTATGCGGAGTTCCTGAAGGCCAAATGTCGAAGTCTTGCCGACACGACAACCACAGTAGAG
ATGGATCCTGATAGCTCTTTCACATTTGATAACGATTACTTTGTTATTCTTAAGCAGCATAAGGGTCTTTTCCAATCTGATGCAGCCCTTCTAACGAACAAGATTGCCAGTAAAATTGCT
GGAGAGTTGCTTAATTCTAAAGCTTTCTTTACAGAGTTTGCTCAGTCAATGAAGAGGATGGGAGCCATTGAAGTTCTTACTGGCTCTAAAGGAGAGATCAGGAAAAAGTGCAGTGTTGTT
AATTCT

Retrieve as FASTA