Entry information : SiAPx03 (Si014221m)
Entry ID 9432
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiAPx03 (Si014221m)
Name (synonym) SiAPx03 (Si014221m)
Class Ascorbate peroxidase    [Orthogroup: APx003]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiAPx03
start..stop
S start..stop
SbAPx04 481 3e-174 1..281 1..289
ZmAPx04 476 3e-172 1..281 1..289
ScAPx04 461 3e-166 1..281 1..291
TaAPx06 458 4e-165 1..281 1..291
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 35047026..35047138 113 N° 2 35046020..35046144 125 N° 3 35045270..35045317 48 N° 4 35045099..35045145 47
N° 5 35044964..35045012 49 N° 6 35044269..35044351 83 N° 7 35044115..35044194 80 N° 8 35043913..35044015 103
N° 9 35043595..35043792 198  
complement(join(35043595..35043792,35043913..35044015,35044115..35044194,3504426 9..35044351,35044964..35045012,35045099..35045145,35045270..35045317,35046020..3 5046144,35047026..35047138))


exon

Literature and cross-references SiAPx03 (Si014221m)
DNA ref. Phytozome 11:   scaffold_6 (35047138..35043595)
Protein sequence: SiAPx03 (Si014221m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   282
PWM (Da):   %s   30786.79 Transmb domain:   %s   o252-274i
PI (pH):   %s   6.53
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAPVVDAEYLRQVDRARRQLRALISNKGCAPIMLRLAWHDAGTYDVNTKTGGANGSIRFEEEYTHGSNAGLKIAIDLLAYQSQEPEDNVRRPLSVEVTGGPTVEFVPGRRDSSVCPREGRLPDAKKGAPHLRDIFYRMGLTDKDIVALSGGHTLGKAHPERSGFEGAWTQEPLKFDNTYFLEMLKGESEGLLQLPTDKALLSDPEFRRYVELYAKDEEAFFKDYAESHKKLSELGFAPRSASAKTDLPTGVVLAQGAFGVAVAAAVVIAGYLYEASKKAK*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCTCCGGTGGTGGACGCCGAGTACCTGCGCCAGGTCGACAGGGCGCGCCGCCAGCTCCGCGCCCTCATCTCCAACAAGGGATGCGCCCCAATCATGCTCCGCCTCGCGTACGTG
CTCCGCCTCTCATCACTACCCCACCTGCTCCCTCACTCCACCCAACCCAACTGCTGACTGGAAACTTTGGGTGCTCTAGTGTTTTCGTCTGTGCCGCGCTTGCTTGCTGATCTCGTGCTT
GACGGTTAAGCCTGCTTGCTGGCTGGCGTGTGAGATTTGCAAAGCCTGGTTTCGTGCTGCGGGTAGCGCGCGTGGTTCGTGCTGGTTTGGTGCGGGCTTTGGGGGAGGCGATTTGTCGAA
CACCTTGCGTGCGTGTCGCTAGCGCTGAAGAGTGAAGATCAAGGGATGATGATTTTTAATTCACATAGGTTTCGGTTGATTGTTAATCTTAGAATCATTAAGATAGTATCCTCACTCAAC
TCACAATCATAACCTACACAGTCTAAGTATACAGTAGGTCAGTAGAGATGCAACTGTAACAACTGTTGTTTCTCAATCCCACATGCAAGCACAGCATAGAGGTTGGAGAAAACAAAGACA
AGTTTCCTGTTCTAGATCAACTGGTTTTTTGCTTTGCTTTGCTTTACTTGTGTGGACTCTGGAATTGCTGAGAGCCGGGTAGGGTACTTGGGAGAAAATGTTTGATTCGATCCACTAATT
GCAGAGTGTAGGTGATGTTCCCTTAGTAACAGCTTGTCATAAGCTTCAATACAAGCACAGTTTTATACGTTGGAGTTCCCAATTTATGTTTTTAGATATATTGGGTTCCTCCCTATTGCA
TTGATCTGATAGCTAGTTAAATTTGCATTTGACCTCCACTATCTGCATGATTAATCCAGGGATACATTCTGCTTGTCATGGATTAGCATTAGCCTTACATCATATGCCCTTTCTTCGAAC
ACTGAAGACTTGGCTCCTTTGCTGTCCTCTGCAGATGGCATGATGCTGGAACTTATGATGTGAACACAAAAACTGGTGGCGCAAATGGTTCAATTAGATTTGAGGAAGAGTACACTCATG
GTTCCAATGCTGGTTTAAAGATTGCTATCGATCTCCTTG
GTAAGCATTGTTAATGCTCAATATGATAGTGGAAATCTGTGCAATAATATTCTTCCTTCTGAAAATATCTGAACAGCAACC
TTTAAACCTAATCAAGTATGAGCTACATGAATGATGGCTTTGAAGAAATTAATTTGCGCCTTTTTCTAGTTTCTTTCTGATAAATTGAAAGTTTGGAACTCCTTTTATTTGGCCACTGGT
TTCTGTGATATCTTCAAGGTCAGGCTACAAAATATTGGATTATTCATGACTGTAATGTTGGGATGCTAAGTTGGGAAACTATATAGTGTGTTTTAGCTACTCAAGGAACATGTCCTCCCC
ATGAATATCTGCTTGGCAATGCAACTTCACAACCGTTGTATCTCAAACCCACATGCAAGCACAGTAGAGAGGTTGGAGAAAACTTAGTTACCTGTTCTCACTCAACTGGGATTAGCTTTG
CTTTACTTAAGTCTGCGCCCTGTCATGCAGTAAGATTGTGTACTCATGACAATGGTTACTTGTATACCATCAAGCCTTAAATGTAAAATCAGAATGTGTCTTTGAGTAAGTACAGTTTAT
GGCATATTCCTTTATGAGTAACACTCCATGTGAATTGATGGTGATTTGCATGCTTATTGTTTTGTTGTTTCTTTATTCTCTGCTGTAATAAAGGAAATCATTACTATTGCTTATCCAACT
GTGCATTGTATTGTACTAGAGCCTATCAAAGCCAAGAACCCGAAGATAACGTACGCAGACCTTTATCAGGTAATTTAGGATTGCTTGAATTTTCTCGTTTAAGTTAAGATATCTGGCTTA
TTTTCCTTTCATTTTTGAGTTTTTTTATTAACTAAGATGCTGGAATTTACTCAGCTTGCTGGAGTGGTTGCAGTTGAAGTGACTGGGGGGCCAACTGTTGAGTTCGTTCCCGGCAGACGT
GTACGTGAAATAACAATTTGTTAATAAATGGATGCATCTTTCTTGATGCTCACTGTTTTTACTTTTTTTTTTTTTGCATGAATCAGGATTCGTCAGTGTGCCCCCGTGAAGGGCGTCTAC
CGGATGCGAAGAAAG
GTATGTACTAGTATTGTTTCTTGTTCTTTTCAATGTCTTTCGATAATGGCTTGAAAGCTATGGGCTAGCATCAATCTTGTGGAATTTGAAGGTTTTTACTGCACC
GCTCATGTTCGTGTCTGCAATGTGCATTTTGGTTTTGTTTCAGACATCCCATTTGATGCAACACAGTTGCCATGTCCTAGTTTTCCCTTTTTTTTCACATGGGCAGAATTTTGTCATTGG
GATTTTTTGGGCACAAAAAACTCTGCATGTGTACGCTTGGTGTAAGCAGCTTGTGTGGAGTAGGTGAGTGAAGGAAGTTTGATACTGTGTTATTAATGCGTAAAATCTTCTTCCTGCTTA
TCAGCATCCAGCTGTTGCATTTATCTGAGCTCCATGATTTCGTTGCCCTGAAGTTATTAAGCAACATAAATAACCTTTTTATATTCAGGAAATGTTGCCTTTTTCCCTCCATTTAACTAA
CCTTAGACGTAGATATAACATGTGCAAGGATCTATCTAACTTGATAATTTTGTCCTGGTTTATGATTGTTATTCCATACTTGTTATGTATCATATCTGTTCTGATGTACATCTTGCTCTT
GTGTTTTCTACTTCTTTGCATGAATAGGTGCACCACATCTGAGGGATATCTTCTATCGGATGGGCTTAACAGACAAAGATATTGTAGCTCTATCTGGAGGTCACACTCTGGTAATTGTTA
TACTGTCTGAAGAAATACTCATTTGTTGAAAAGCGCATTTTTATACGTTTGTATGTTCTTTTAGGGAAAGGCTCATCCTGAGAGGTCTGGATTCGAAGGTGCCTGGACACAAGAGCCTCT
TAAGTTTGATAACACATACTTTCT
GTAAGTTGAGCACAAAGGCCAAATCTCACGCGTTTTGTAGAGTAGATTTGATACGGTATCCAACGCTATGTAGATTACTCATCTCTTATATTGTTG
CAGTGAGATGTTGAAGGGGGAATCTGAGGGGCTTTTGCAGCTCCCTACTGACAAGGCACTGTTGTCGGATCCTGAATTTAGGCGCTATGTTGAGCTTTATGCAAAGGTGCGCTGCACTTT
TAATATTCTTTAGTACAGTGTTCTACTTAGTATGCTAGCGCTTTTGTCTCATCACATTAGGTTCAGATCAACTGATTCAGAACCATGGCCTTGTTTCATGCCCCAGGATGAAGAAGCCTT
CTTCAAAGACTACGCTGAATCACACAAAAAACTCTCTGAGCTTGGCTTTGCTCCTCGCAGCGCATCTGCAAAAACAGATCTTCCAACCGGTGTTGTGCTTGCACAGGGTGCCTTTGGGGT
AGCAGTTGCTGCAGCTGTAGTTATTGCAGGCTACTTGTATGAGGCTTCCAAGAAGGCCAAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCTCCGGTGGTGGACGCCGAGTACCTGCGCCAGGTCGACAGGGCGCGCCGCCAGCTCCGCGCCCTCATCTCCAACAAGGGATGCGCCCCAATCATGCTCCGCCTCGCATGGCAT
GATGCTGGAACTTATGATGTGAACACAAAAACTGGTGGCGCAAATGGTTCAATTAGATTTGAGGAAGAGTACACTCATGGTTCCAATGCTGGTTTAAAGATTGCTATCGATCTCCTTG
CC
TATCAAAGCCAAGAACCCGAAGATAACGTACGCAGACCTTTATCAG
TTGAAGTGACTGGGGGGCCAACTGTTGAGTTCGTTCCCGGCAGACGTGATTCGTCAGTGTGCCCCCGTGAAGGG
CGTCTACCGGATGCGAAGAAAG
GTGCACCACATCTGAGGGATATCTTCTATCGGATGGGCTTAACAGACAAAGATATTGTAGCTCTATCTGGAGGTCACACTCTGGGAAAGGCTCATCCT
GAGAGGTCTGGATTCGAAGGTGCCTGGACACAAGAGCCTCTTAAGTTTGATAACACATACTTTCT
TGAGATGTTGAAGGGGGAATCTGAGGGGCTTTTGCAGCTCCCTACTGACAAGGCA
CTGTTGTCGGATCCTGAATTTAGGCGCTATGTTGAGCTTTATGCAAAG
GATGAAGAAGCCTTCTTCAAAGACTACGCTGAATCACACAAAAAACTCTCTGAGCTTGGCTTTGCTCCTCGC
AGCGCATCTGCAAAAACAGATCTTCCAACCGGTGTTGTGCTTGCACAGGGTGCCTTTGGGGTAGCAGTTGCTGCAGCTGTAGTTATTGCAGGCTACTTGTATGAGGCTTCCAAGAAGGCC
AAGTAG

Retrieve as FASTA