Entry information : SiAPx06 (Si010652m)
Entry ID 9435
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiAPx06 (Si010652m)
Name (synonym) SiAPx06 (Si010652m)
Class Ascorbate peroxidase    [Orthogroup: APx002]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiAPx06
start..stop
S start..stop
HvAPx05 590 0 1..311 1..312
TaAPx03 587 0 1..311 1..313
SbAPx06 584 0 1..311 1..313
ZmAPx06 569 0 1..311 1..313
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 33048836..33048916 81 N° 2 33048630..33048743 114 N° 3 33048164..33048284 121 N° 4 33047990..33048090 101
N° 5 33047810..33047897 88 N° 6 33046902..33046969 68 N° 7 33046740..33046826 87 N° 8 33046107..33046181 75
N° 9 33045957..33046034 78 N° 10 33045763..33045867 105 N° 11 33045653..33045670 18  
complement(join(33045653..33045670,33045763..33045867,33045957..33046034,3304610 7..33046181,33046740..33046826,33046902..33046969,33047810..33047897,33047990..3 3048090,33048164..33048284,33048630..33048743,33048836..33048916))


exon

Literature and cross-references SiAPx06 (Si010652m)
DNA ref. Phytozome 11:   scaffold_7 (33048916..33045653)
Protein sequence: SiAPx06 (Si010652m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   312
PWM (Da):   %s   33921.44  
PI (pH):   %s   8.1
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVHHLLRRGVSGGFPLHPLRGLLASQELGRRPLSSAAGDAAAELRGAREDVKQLLKTTSCHPILVRLGWHDAGTYDKNIAEWPKCGGANGSLRFEIELKHGANAGLVNALKLIQPIKDKFSGVTYADLFQLASATAIEAGGPKIPMIYGRVDITAPEQCPPEGRLPAAGPPSPAEHLREVFYRMGLNDEIVALSGAHTLGRARPERSGWGKPETKYTKNGPGAPGGQSWTSQWLKFDNSYFKDVKERRDEDLLVLPTDAVLFEDSSFKVYAEKYAEDQDAFFKDYAEAHAKLSNLGAKFDPPKGISLE*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGTCCACCACCTCCTCCGCCGCGGGGTCTCCGGCGGCTTCCCGCTCCACCCGCTCCGCGGCCTCCTCGCCTCCCAGGTACCGGCGACTCCTCCCCTCGGCTCCCCCATTCTTCTT
GTGGTCACACATGTTCTTGATTTTGCCGTCTGTTTATATTCCCGGCGGCGCAGGAGCTCGGGCGGCGTCCGTTGAGCTCGGCGGCAGGGGATGCGGCGGCCGAGCTGAGGGGCGCGCGGG
AGGACGTCAAGCAGCTGCTCAAGACCACCTCCTGCCATCCCATCCTG
GTACGGTATTTCTCCTCGTGCAAATTCCTAGGCTTCATGTGGGTTGAGCAGACAAGTGATTGTGTTCGGCTTG
ATGGAATTTTGCATCTGTACAAAAGTTAAGTTTTTTTCTCTCACGTTTCGTGCAATTGATGAACCAATACTGCAACCTTTTGTTTTGGGTAAGGAACGGACTCGTGCGATTTAGTTGGCA
GATGTACTGGTCTGTTTATGCTAGATCAATTTTGTTCTTTGTGCTTTGTGTGCACTATTTTTTGCACCTTCTCGATTCAGCATTAGATGATTCAGCCTTTGAGTTGCCTAGATACGAGTA
TGGCTTTTGTGATGTTTTATCGTTTGGTTCAGGTTCGATTGGGTTGGCATGATGCTGGTACCTATGACAAGAACATTGCTGAGTGGCCCAAGTGCGGTGGAGCTAATGGTAGCTTGAGAT
TTGAAATTGAGTTAAAGCACGGGGCTAATGCTG
GTAGTGCTTCTCCTCCATCAATCATCTGTAGCTTCATGATGAGTTGCCATTCTTATATTTAGTTCTGCGACAGGTCTTGTGAATGCT
TTGAAGCTGATCCAACCGATCAAGGACAAGTTTTCAGGTGTCACATATGCAGATCTCTTTCAGCTTGCCAGCGCCACAGCCATTGAG
GTCTGTTATTGTACTTCAGCTTTAAGTGAGATG
ATTGTTGGAAAATGCTTCTTGTTAATAATGACTGGATGTTTTGATTTCTTTCATTTCAGGAAGCAGGTGGCCCCAAAATTCCCATGATCTATGGAAGGGTTGACATTACTGCCCCTGAAC
AATGCCCACCAGAGGGGAGGCTTCCTG
GTTAGTGAGTACTAACATTAAGATTTGGAACCTTACTCGCCATTTTAGTTCCTTGAGACTTGAGTGGCACCGCACATGGAGCTTTCAGCTAAA
ACATAACCTTATTAAATATTACTGGATTTAAGCTCTTGTTACCAAACTTGTTTACTTGGTTAGTTGCTTATGAAAGCTTAAAATCTCAGTATACTGGTAGCTTTCAATAGATTATTATGA
CGTGAGTTAATATTCATGTCACAGAAAATGAATTTAGCATTTCAACATAAATTTGCACGCACAAAGAATTTAACTGACAGATTTACTCCATTCAACGTTTACAACAACAACATCATCAAC
ACCAACAATACTTCCCTGCCAACTTTTAATGATAGTCTTGTCCTGTATCATCACAAATTAGCATTTTTTATCTTGCTATTCCTATAGTGTTTGTTGGGTTCCTTATAGTGCCACTACATA
ACTTGCTGAGGCGGTTAAGACTTAGGCCAAATTAGTCTATATATTTGTAAAATTTAATTTGCAACTTGAAGGGTACAAACAGGCTAAAGGCCTGTAAGAGGCCTATGTGATTTATAAAGC
TCAAGTTTCTTGCACATTTATCATGTGAGGTCTATGGTAGGTCCAAGTCACATGGCTGAATGTACAGAATGCACGAGATAAATTATTTGAACTACCCATGTTTTCAAGTATTTTTTTTCT
ATCCAAGGGTCCCTGATAGATTTCTTCCTATGCCATTATGTACAGAAGTAAAATCTAGTCTATATTACCTTTGGCGTGACAATGTTTTATGTGTATGGCAGATTTTATTCCGAGGTCACT
AATATTTCTGTTTCTTCACCCATTCAGCTGCCGGTCCACCTTCACCTGCGGAACATTTGCGTGAAGTATTCTATAGAATGGGCCTGAATGACAAGGTACTCGCAGCCTGTTTAATTATTC
AGCACAACATAATTCTGGATTTTATAGTCATATCTGCGTTTTCTCTATAGGAAATTGTTGCACTATCAGGAGCTCATACGCTTGGACGGGCAAGACCAGAACGTAGTGGCTGGGGCAAAC
CAGAAACAAAATACACT
GTACGTAACTTACAACTTTAGTTTCTTGTGCTCGTTATGAACTTGGGTTTTCATTCGTAGTTCTTTTGGATTATTATATGTTCGCGGGATTAGGCAGTGAAAT
ATTGCCAAAATTGGCTACTTGTGCTAGTTACTTTCTCATTTATCTGTCTCCTATAAGTGTATTGATTGGTCCTTGCATATACGCATATGCTTCCTGCGTAAGCACCTTGTTTGGTTGCTA
ACATGTGCTGCTGGTAAGATAATTGCTTGCTGGAAGGAAAATTAATAGAACGTTTCTGTTGTTCACCGGAGCGAAGAATAAGACTAATGATTATTCTTCCCTGGAATCGATAGGAATTCT
TTTGTTGAATGACATATATGAATTGTCACCGCAAGCTTTTCCCTCCATAGGCCTTATCCTTTTTTCCACCATTGTTATCCTTGTAAGATGATTGTTGCTTGTTGTGGACGATGCCTTGTA
GTAGCATCTATCCTATCATAAAGCTCTTGCTGAAGTGTGTTGAGAGTAGTGCATCTGATTCTTTGGCAATTGCTTTTTTTACTTGGACATGCTAGAAAAATGGACCTGGGGCACCTGGGG
GGCAGTCTTGGACATCTCAGTGGCTAAAGTTCGACAATAGCTACTTCAAG
GTAGGGTACCTATTTGCTCTAGGATTACCTGCAATCATGTAGCAGTAGCTTAAATCTGGGCATACAATGC
AGGATGTCAAAGAAAGGCGGGATGAGGACCTTCTAGTTTTGCCTACTGATGCTGTGCTGTTTGAGGATTCCTCATTCAAGGTTAGTGAGGGGTTCTCATGTTGCAGGAAACTGCACATCT
CTAGCTTATTCTCTGAACCAAGTCTCATGATGACTTCGCGTGCTTGAAGGTCTATGCTGAAAAATATGCTGAGGACCAGGATGCATTTTTCAAGGACTATGCTGAAGCTCATGCTAAATT
AAGCAACCTTGGGGCAAAATTTGACCCACCAAAG
GTAGATGGAATCAAGACAATTCCCACTCTTGAGAGGTAAACAATAATTATGTTGTCAGGTCATGTAACATGGTATTCATTGGCATG
TTGCAGGGTATCTCTCTTGAGTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCGTCCACCACCTCCTCCGCCGCGGGGTCTCCGGCGGCTTCCCGCTCCACCCGCTCCGCGGCCTCCTCGCCTCCCAGGAGCTCGGGCGGCGTCCGTTGAGCTCGGCGGCAGGGGAT
GCGGCGGCCGAGCTGAGGGGCGCGCGGGAGGACGTCAAGCAGCTGCTCAAGACCACCTCCTGCCATCCCATCCTG
GTTCGATTGGGTTGGCATGATGCTGGTACCTATGACAAGAACATT
GCTGAGTGGCCCAAGTGCGGTGGAGCTAATGGTAGCTTGAGATTTGAAATTGAGTTAAAGCACGGGGCTAATGCTG
GTCTTGTGAATGCTTTGAAGCTGATCCAACCGATCAAGGACAAG
TTTTCAGGTGTCACATATGCAGATCTCTTTCAGCTTGCCAGCGCCACAGCCATTGAG
GAAGCAGGTGGCCCCAAAATTCCCATGATCTATGGAAGGGTTGACATTACTGCCCCTGAACAA
TGCCCACCAGAGGGGAGGCTTCCTG
CTGCCGGTCCACCTTCACCTGCGGAACATTTGCGTGAAGTATTCTATAGAATGGGCCTGAATGACAAGGAAATTGTTGCACTATCAGGAGCTCAT
ACGCTTGGACGGGCAAGACCAGAACGTAGTGGCTGGGGCAAACCAGAAACAAAATACACT
AAAAATGGACCTGGGGCACCTGGGGGGCAGTCTTGGACATCTCAGTGGCTAAAGTTCGAC
AATAGCTACTTCAAG
GATGTCAAAGAAAGGCGGGATGAGGACCTTCTAGTTTTGCCTACTGATGCTGTGCTGTTTGAGGATTCCTCATTCAAGGTCTATGCTGAAAAATATGCTGAGGAC
CAGGATGCATTTTTCAAGGACTATGCTGAAGCTCATGCTAAATTAAGCAACCTTGGGGCAAAATTTGACCCACCAAAG
GGTATCTCTCTTGAGTAG

Retrieve as FASTA