Entry information : SiPrx03 (Si001958m)
Entry ID 9437
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-12-12 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx03 (Si001958m)
Name (synonym) SiPrx03 (Si001958m)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx03
start..stop
S start..stop
ZmPrx143 608 0 4..362 8..362
BdiPrx67 586 0 7..361 9..354
SbPrx63 552 0 5..355 7..366
OsPrx16 491 6e-176 20..336 18..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 14031882..14032100 219 N° 2 14033878..14034747 870  
join(14031882..14032100,14033878..14034747)


exon

Literature and cross-references SiPrx03 (Si001958m)
DNA ref. Phytozome 12:   scaffold_5 (14031882..14034747)
Protein sequence: SiPrx03 (Si001958m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   362
PWM (Da):   %s   38352.24 Transmb domain:   %s   i5-27o
PI (pH):   %s   6.88
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MKGFFFFFTTSALAILALLPVVAIGAGLKVGFYNKSCPSAESLVQQAVAAAFKNNSGIAAGLIRLHFHDCFVRGCDGSVLIDTTSNNTAEKDAPPNNPSLRGFEVIDAAKKAIEARCPKVVSCADILAFAARDAVALSGNNLTYKVPAGRRDGRISRDTDASNNLPSPLSNATELVGNFTVKNLTAEDMVVLSGAHTVGRSHCSSFTNRLYGFSNASDVDPTISSAYAFLLRGICPSNSSQFFPNTTTEMDLMTPAVLDNKYYLGLANNLGLFTSDQALLTNATLKKSVDEFVKSENRWRSKFAKAMVKMGNIEVLTGTQGEIRLNCRVINSGSSSAGIELQMATGSGGDDSAEEFTDIATN*

Retrieve as FASTA  
Remarks Complete sequence from genomic. Incorrect prediction from phytozome (3' end is missing).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGGCTTCTTCTTCTTCTTCACCACCTCTGCACTTGCCATCCTTGCGCTCCTCCCGGTCGTCGCCATAGGCGCCGGCCTCAAGGTCGGGTTCTACAACAAGTCCTGCCCGTCGGCG
GAGTCGCTGGTGCAGCAGGCGGTGGCTGCCGCCTTCAAGAACAACAGTGGCATCGCCGCCGGCCTCATCCGCCTGCACTTTCATGACTGCTTCGTCAGG
GTATGTGCTCTCGTACATGAA
TGCTTTGTAATACAAGTTGTACACTTGTACTATTTTTACAAACAGATGATCGTGCTGATCGACTGGACGAGCACCCAGCAAACATTATCTGTACTTTAACTTTAAATGAACTAATGAATA
CAGTTAGCAAGAATTAGGTGGATGATAAATAGAGTTAGCTACCCACATCTCATTTACAATTTGCTTAGGTACCGTTGACTAGTGCGTTCCGACTGGCCGAGTCTTTCTTGTGGACATCGG
TTACTTTTACACACATGCATCTCGGGTGCTTTAGTTGTTTCTGGTCCCAGACGTGTGTGTGAGGTATGGGTATGGCGACGAAAAAGATGACCATGACTATGCATAGCATAGTGGCTAGCA
GTAGCACTGCACATATCCATTCACAAAATGTGTAGCCGGCCGGAAAATTCAAGTCTGATCCACATCCACTGTTTGCGTAGCTGCACTTGTGACTTAGTTACTGTTACTGATGAGCGATGA
CGGTCCATATGATTCCTTTGTAGTATGCATGTTGTGTATCTTTAAGCAAAGCATAGTAGAAAGAGGTCCTGCCAGAATAACAAATTTCGCAAAGCAAGGAACAAGACAGATCGGCAATCT
ATCATTTTTGCAGCAGTCTCTTGCAAATAAAAGGGAGTGCCAGTGTTTGAAGAATATAGACGACATATATGAAACTTTATCCCTTTCGAGAAAGAAGCACACATGGACTAGTTAATTGCA
ACAGTTATTGAGCTGCTGGTTAAGTACTCCATGCATGCCTCCGTTATCATGAGCTCTATTTGCATACTTTCCTTTATACTCAGAATAGTTTTCATTTGGTAAATGGCTGAACAACATGTT
TCAGACATCAGTAAGAACTGTAACATCAGCTTTTTGCTAAAAAATATAATTAATACGAAAGACAATAATAAAAATGAATGGATACGGTTAGGAACCAAAATCGCATTTATTTTTGTTTAG
GTACCGTGTTGACTAGTGCTTGCCGACTGCCCAACTCATAGATGTTGCGGCACACATGTATCTCGATGGCTGTACTTGTTGCTGGGCCCAGGCAGACGTGTGTACTTGTATGGCAACTAC
AAAGACAGAGATAGATGACCTTGACCATGACCTTGTGGCGACCACTGCAAATGCATTTCTCTTGAAACAACGCCTAGCAGTTGCTTGCTGCTAATACTGTGGAGATTTAGTAGTCCCTTG
CTAAAAACCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATATATGTAGTTGGAAAATTTTATGTTCATGTCTAATCCACATCTAGCTTACCTTCAAGCAACCTAATAAGATGACACATGTGCACA
AACAATTCCTAGAAAGGACGACCAGTAATCTTTAGCTGGACTTGCAGGGGGAAAAAAAAGCTAAGTACCTGCAGCATGAACCTAATGCAATTCAGAGAGATGAGCGTCAGTTTTGTTTGT
GTTATCATGAACTTATGATGCAAGTAACTAAGATCATGTCAAATAGTAAAAATTTCATGGCGGACGCGTTACGCAGGGCTGCGACGGCTCCGTGCTGATCGACACGACGTCGAACAACAC
GGCGGAGAAGGACGCGCCCCCGAACAACCCCAGCCTGCGTGGCTTCGAGGTCATCGACGCCGCCAAGAAGGCCATCGAGGCGCGGTGCCCCAAGGTCGTCTCCTGCGCCGACATCCTCGC
CTTCGCGGCGCGCGACGCCGTCGCTCTGTCGGGGAACAACCTCACCTACAAGGTACCCGCGGGGCGGCGCGATGGGCGGATCTCCAGGGACACGGACGCCAGCAACAACCTCCCTTCCCC
GCTCTCCAACGCCACCGAGCTCGTCGGCAACTTCACCGTCAAGAACCTCACCGCCGAGGACATGGTGGTGCTCTCCGGCGCGCACACCGTCGGCCGTTCCCACTGCTCCTCCTTCACCAA
CCGCCTCTATGGCTTCAGCAACGCCAGCGACGTGGACCCCACCATCAGCTCCGCCTACGCGTTCCTGCTCAGGGGCATCTGCCCCTCCAACAGCAGCCAGTTCTTCCCCAACACGACCAC
GGAGATGGACCTCATGACGCCGGCGGTGCTCGACAACAAGTACTACCTGGGGCTCGCCAACAACCTGGGGCTCTTCACGTCGGACCAGGCGCTGCTCACCAACGCCACGCTCAAGAAGTC
CGTCGACGAGTTCGTCAAGAGCGAGAACAGGTGGAGGAGCAAGTTCGCCAAGGCCATGGTGAAGATGGGCAACATCGAGGTGCTCACGGGGACGCAGGGGGAGATCAGGCTCAACTGCAG
GGTCATCAACAGCGGCAGCAGCTCGGCCGGGATCGAGCTTCAGATGGCGACAGGCTCCGGTGGCGACGACTCTGCCGAAGAATTCACTGACATTGCAACGAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAAGGGCTTCTTCTTCTTCTTCACCACCTCTGCACTTGCCATCCTTGCGCTCCTCCCGGTCGTCGCCATAGGCGCCGGCCTCAAGGTCGGGTTCTACAACAAGTCCTGCCCGTCGGCG
GAGTCGCTGGTGCAGCAGGCGGTGGCTGCCGCCTTCAAGAACAACAGTGGCATCGCCGCCGGCCTCATCCGCCTGCACTTTCATGACTGCTTCGTCAGG
GGCTGCGACGGCTCCGTGCTG
ATCGACACGACGTCGAACAACACGGCGGAGAAGGACGCGCCCCCGAACAACCCCAGCCTGCGTGGCTTCGAGGTCATCGACGCCGCCAAGAAGGCCATCGAGGCGCGGTGCCCCAAGGTC
GTCTCCTGCGCCGACATCCTCGCCTTCGCGGCGCGCGACGCCGTCGCTCTGTCGGGGAACAACCTCACCTACAAGGTACCCGCGGGGCGGCGCGATGGGCGGATCTCCAGGGACACGGAC
GCCAGCAACAACCTCCCTTCCCCGCTCTCCAACGCCACCGAGCTCGTCGGCAACTTCACCGTCAAGAACCTCACCGCCGAGGACATGGTGGTGCTCTCCGGCGCGCACACCGTCGGCCGT
TCCCACTGCTCCTCCTTCACCAACCGCCTCTATGGCTTCAGCAACGCCAGCGACGTGGACCCCACCATCAGCTCCGCCTACGCGTTCCTGCTCAGGGGCATCTGCCCCTCCAACAGCAGC
CAGTTCTTCCCCAACACGACCACGGAGATGGACCTCATGACGCCGGCGGTGCTCGACAACAAGTACTACCTGGGGCTCGCCAACAACCTGGGGCTCTTCACGTCGGACCAGGCGCTGCTC
ACCAACGCCACGCTCAAGAAGTCCGTCGACGAGTTCGTCAAGAGCGAGAACAGGTGGAGGAGCAAGTTCGCCAAGGCCATGGTGAAGATGGGCAACATCGAGGTGCTCACGGGGACGCAG
GGGGAGATCAGGCTCAACTGCAGGGTCATCAACAGCGGCAGCAGCTCGGCCGGGATCGAGCTTCAGATGGCGACAGGCTCCGGTGGCGACGACTCTGCCGAAGAATTCACTGACATTGCA
ACGAACTAG

Retrieve as FASTA