Entry information : SiPrx04 (Si001960m)
Entry ID 9438
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-12-12 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx04 (Si001960m)
Name (synonym) SiPrx04 (Si001960m)
Class Class III peroxidase     [Orthogroup: Prx007]*
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx04
start..stop
S start..stop
SiPrx07 441 7e-156 34..362 35..356
SbPrx69 439 3e-155 19..355 18..352
OsPrx23 438 7e-155 9..362 4..358
ZmPrx139 434 3e-153 21..362 21..357
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 46891912..46892166 255 N° 2 46892255..46892443 189 N° 3 46892558..46893202 645  
join(46891912..46892166,46892255..46892443,46892558..46893202)


exon

Literature and cross-references SiPrx04 (Si001960m)
DNA ref. Phytozome 12:   scaffold_5 (46891912..46893202)
Protein sequence: SiPrx04 (Si001960m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   362 (336)
PWM (Da):   %s   39040.05 (36686.8) Transmb domain:   %s   i9-31o
PI (pH):   %s   8.83 (8.59) Peptide Signal:   %s   cut: 27 range:27-362
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARAGTSRAAAAVALVVAVLCASAAAEAGITRPPPVARGLSFNFYKKTCPNAEALVRGFVHDAIQRDVGLAAGLLRLHFHDCFVQGCDASLLLDDEHGEQKALPNLTLRREAITAINDIRDRLDKACGGPVVSCADILTLAARDAVVERGGPRYKVPLGRRDNVNFASHDEVNKGLPSPDANVGAMLEVLRKGNLGLDATDLVALSGAHTIGLSHCTSFENRLFPRQDSTMDAAFAAQLKQTCPAKGVSRTTPLDVRTSDVFDKMYFVNLVNRQGLLTSDQDLFTEARTRPAVQRFARSQNAFFRQFRVSMVKMGQIKVLTGDQGQVRRNCSATNNLMRTTSTAAGLPWWFVVPEAETSLVF*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGTGCAGGTACTAGTAGGGCCGCCGCCGCAGTGGCTCTAGTGGTTGCCGTCCTCTGCGCCTCTGCCGCGGCGGAGGCCGGGATCACCAGGCCGCCGCCGGTGGCGCGTGGCCTG
TCGTTCAACTTCTACAAGAAGACCTGCCCCAACGCGGAGGCCTTGGTGCGGGGGTTCGTGCACGACGCCATCCAGCGGGACGTGGGCCTCGCCGCGGGGCTCCTCCGCCTCCATTTCCAC
GACTGCTTCGTCCAG
GTAGATGGAGCTTCATTCTTTGGATCACTCCAACAGCAGGGCGTAACCGTGTCGGATCGATGAACTCGACGTGCGTATGCATGCGCAGGGGTGCGACGCGTCCCT
GCTGCTGGACGACGAGCACGGCGAACAGAAGGCCCTCCCCAACCTGACGCTCCGCCGGGAGGCGATCACGGCCATCAACGACATCCGTGACCGCCTCGACAAGGCCTGCGGCGGCCCCGT
CGTGTCCTGCGCCGACATCCTCACGCTCGCTGCCCGCGACGCCGTCGTCGAG
GTACGCGCTCCGATCCGATCCTTGGCGGGCACGTCGTCGTCCCTCTGCTCCGGTTGCCAGCAGCCAGA
AGAACCTGAACTCACCATGCGCTGCTCCTTGTTACATATGCTGCAGAGGGGAGGGCCGAGGTACAAGGTGCCCCTGGGGCGTCGCGACAACGTCAACTTCGCGTCGCATGATGAAGTCAA
CAAGGGGCTCCCGAGCCCTGATGCCAACGTCGGCGCGATGCTGGAGGTGCTGCGCAAGGGCAACCTCGGCCTCGACGCCACCGACCTGGTGGCGCTCTCCGGCGCGCACACCATCGGCCT
CAGCCACTGCACCTCCTTCGAGAACCGCCTCTTCCCGCGGCAGGACTCCACCATGGACGCCGCCTTCGCCGCCCAGCTGAAGCAGACCTGCCCGGCCAAGGGCGTCAGCAGGACGACGCC
GCTCGACGTCCGCACGTCCGACGTCTTCGACAAGATGTATTTCGTCAACCTGGTCAACCGGCAGGGGCTCCTCACCTCCGACCAGGACCTCTTCACCGAGGCCAGGACCAGGCCCGCCGT
CCAACGGTTCGCGCGGAGCCAGAATGCCTTCTTCCGCCAGTTCAGGGTCTCCATGGTCAAGATGGGGCAGATCAAGGTGCTCACCGGCGACCAGGGCCAGGTCCGACGCAACTGCTCGGC
GACCAACAACCTGATGCGCACCACCAGTACCGCCGCCGGCCTGCCGTGGTGGTTCGTCGTCCCCGAGGCAGAGACGAGCCTCGTGTTCTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTCGTGCAGGTACTAGTAGGGCCGCCGCCGCAGTGGCTCTAGTGGTTGCCGTCCTCTGCGCCTCTGCCGCGGCGGAGGCCGGGATCACCAGGCCGCCGCCGGTGGCGCGTGGCCTG
TCGTTCAACTTCTACAAGAAGACCTGCCCCAACGCGGAGGCCTTGGTGCGGGGGTTCGTGCACGACGCCATCCAGCGGGACGTGGGCCTCGCCGCGGGGCTCCTCCGCCTCCATTTCCAC
GACTGCTTCGTCCAG
GGGTGCGACGCGTCCCTGCTGCTGGACGACGAGCACGGCGAACAGAAGGCCCTCCCCAACCTGACGCTCCGCCGGGAGGCGATCACGGCCATCAACGACATCCGT
GACCGCCTCGACAAGGCCTGCGGCGGCCCCGTCGTGTCCTGCGCCGACATCCTCACGCTCGCTGCCCGCGACGCCGTCGTCGAG
AGGGGAGGGCCGAGGTACAAGGTGCCCCTGGGGCGT
CGCGACAACGTCAACTTCGCGTCGCATGATGAAGTCAACAAGGGGCTCCCGAGCCCTGATGCCAACGTCGGCGCGATGCTGGAGGTGCTGCGCAAGGGCAACCTCGGCCTCGACGCCACC
GACCTGGTGGCGCTCTCCGGCGCGCACACCATCGGCCTCAGCCACTGCACCTCCTTCGAGAACCGCCTCTTCCCGCGGCAGGACTCCACCATGGACGCCGCCTTCGCCGCCCAGCTGAAG
CAGACCTGCCCGGCCAAGGGCGTCAGCAGGACGACGCCGCTCGACGTCCGCACGTCCGACGTCTTCGACAAGATGTATTTCGTCAACCTGGTCAACCGGCAGGGGCTCCTCACCTCCGAC
CAGGACCTCTTCACCGAGGCCAGGACCAGGCCCGCCGTCCAACGGTTCGCGCGGAGCCAGAATGCCTTCTTCCGCCAGTTCAGGGTCTCCATGGTCAAGATGGGGCAGATCAAGGTGCTC
ACCGGCGACCAGGGCCAGGTCCGACGCAACTGCTCGGCGACCAACAACCTGATGCGCACCACCAGTACCGCCGCCGGCCTGCCGTGGTGGTTCGTCGTCCCCGAGGCAGAGACGAGCCTC
GTGTTCTAG

Retrieve as FASTA