Entry information : SiPrx111 (Si026617m)
Entry ID 9456
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx111 (Si026617m)
Name (synonym) SiPrx111 (Si026617m)
Class Class III peroxidase    [Orthogroup: Prx008]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx111
start..stop
S start..stop
SbPrx83 590 0 7..331 4..331
SbPrx105 587 0 2..331 1..328
SiPrx54 586 0 10..331 2..321
ZmPrx115 582 0 8..331 34..360
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 888575..888820 246 N° 2 888264..888455 192 N° 3 888012..888177 166 N° 4 887021..887412 392
complement(join(887021..887412,888012..888177,888264..888455,888575..888820))


exon

Literature and cross-references SiPrx111 (Si026617m)
DNA ref. Phytozome 12:   scaffold_8 (888820..887021)
Protein sequence: SiPrx111 (Si026617m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   332 (296)
PWM (Da):   %s   34906.3 (31371.5) Transmb domain:   %s   i13-35o
PI (pH):   %s   8.09 (7.66) Peptide Signal:   %s   cut: 36 range:36-331
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MIMATRAASAARCSSSVIALLLLLVVMAGTSSSSAQLSTGFYSYSCPGVYDAVKSVVQAAIAREQRMGASILRLFFHDCFVQGCDASLLLDDTSSFQGEKMATPNNGSVRGFEVIDAIKSAVEKVCPGVVSCADILAIAARDSVVILGGPNWDVKVGRRDSTTASFSGANNNIPPPTSGLANLTSLFAAQGLSQKDMVALSGAHTIGQARCTNFRAHVYNDTNIDGAFARTRQSACPRTSGSGDNNLAPLDLQTPTAFENNYYKNLVCKKGLLHSDQELFNGGSTDAQVQSYVSSQSAFFADFVTGMIKMGGITPLTGSNGEIRKNCRRIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATCATGGCTACTCGTGCAGCATCAGCTGCAAGGTGCAGCAGCAGCGTCATCGCCCTCCTACTCCTGCTCGTCGTGATGGCCGGCACCTCGTCGTCGTCGGCGCAGCTGTCCACCGGC
TTCTACTCCTACTCGTGCCCCGGCGTGTACGACGCCGTCAAGTCAGTGGTGCAGGCCGCCATCGCTAGGGAGCAGCGCATGGGGGCCTCCATCCTCCGACTCTTCTTCCACGACTGCTTC
GTCCAA
GTACGTAATCCATCAACCGGACAGCATTGCCATGATCACTGCTGGTGATCTACACAAGATCGATCGAGAACACTATATATTATTGTGTTTAATGTGACGATGCATATATATACA
TGTAGGGTTGCGACGCGTCGCTGCTGCTGGATGACACGTCCAGCTTCCAGGGCGAGAAGATGGCGACGCCAAACAACGGCTCCGTCAGAGGATTCGAGGTCATCGACGCCATCAAATCCG
CCGTAGAAAAAGTCTGCCCCGGCGTCGTCTCCTGCGCCGACATCCTTGCCATCGCCGCAAGGGACAGCGTCGTCATT
GTAAGATCCCCTGTTCCTTCTTTGACGTACTCACTCTGAAAGA
ATGGAATGAAACTGAACCTGCAACCACTGATGCGTGGGTGCAGCTGGGCGGGCCCAACTGGGACGTCAAGGTTGGGAGGAGGGACTCCACCACGGCCAGCTTCAGCGGCGCCAACAACAA
CATCCCGCCGCCGACGTCGGGCCTCGCCAACCTGACATCCCTCTTCGCTGCGCAGGGACTATCCCAAAAGGACATGGTCGCGCTCTCCG
GTGTGTGATTCCCTACTCCATGCATGTCACC
AAACAAAATTCAAAATTAAAGCATTCTATCGCACACCAAACTATGACGGGATTTATTTCATTACTCACTAGACCGATGATGAGTTGACCATAAGTTGGCCAGAAACGGTGATAGAAAGGG
TAAACGATGGTGACTTACAACAGATTGCCGGCATCGTATTCTCAAAGATAAAGTATTGCCAAAACTTTAAAAAATTTTAAAAGTGGAGCCAACTAAAAAGCGACGACTTTAATGAACTGT
CAATGGCTGAAAGATCATTCTTCCACGAGGTATCTTAATTCAACGAAATATACTAAAGCAAGCATAATATAAAGTATGTCCACATTCCCTATACATTCCTATATACAAGGTTAGGTAGAA
CACTACACATGTGGTTCCTTTTGTTTAGCTCCATGTATAGAATCAAATACCTTTAGCCTTCTTACAAATTTAGAGAACCATGAACAGCCTGTACATTTCAAAAAGAAGATGCTTCAAAAC
TTTATTTGATAAATTAATTTTGTGATTTTGGATCAGGCTTCACACTAAAAACATTTCCTTCTGTGTGTTGCCTTGCATCCTTTTCCAGGAGCCCATACCATTGGCCAAGCACGCTGCACC
AACTTCAGGGCCCACGTCTACAATGACACCAACATCGATGGCGCCTTTGCAAGAACGAGGCAATCAGCATGTCCTCGAACCTCAGGTTCAGGTGACAACAATTTGGCTCCTCTGGACCTT
CAAACCCCAACCGCATTTGAGAACAACTACTACAAGAATCTTGTTTGCAAGAAGGGGCTTCTGCACTCTGACCAGGAGCTCTTCAACGGTGGATCCACCGATGCACAAGTCCAATCATAC
GTTAGTAGCCAGAGCGCATTTTTCGCTGATTTTGTGACGGGCATGATCAAGATGGGTGGCATCACACCACTGACGGGCTCCAACGGGGAGATCAGGAAGAACTGCAGAAGGATTAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGATCATGGCTACTCGTGCAGCATCAGCTGCAAGGTGCAGCAGCAGCGTCATCGCCCTCCTACTCCTGCTCGTCGTGATGGCCGGCACCTCGTCGTCGTCGGCGCAGCTGTCCACCGGC
TTCTACTCCTACTCGTGCCCCGGCGTGTACGACGCCGTCAAGTCAGTGGTGCAGGCCGCCATCGCTAGGGAGCAGCGCATGGGGGCCTCCATCCTCCGACTCTTCTTCCACGACTGCTTC
GTCCAA
GGTTGCGACGCGTCGCTGCTGCTGGATGACACGTCCAGCTTCCAGGGCGAGAAGATGGCGACGCCAAACAACGGCTCCGTCAGAGGATTCGAGGTCATCGACGCCATCAAATCC
GCCGTAGAAAAAGTCTGCCCCGGCGTCGTCTCCTGCGCCGACATCCTTGCCATCGCCGCAAGGGACAGCGTCGTCATT
CTGGGCGGGCCCAACTGGGACGTCAAGGTTGGGAGGAGGGAC
TCCACCACGGCCAGCTTCAGCGGCGCCAACAACAACATCCCGCCGCCGACGTCGGGCCTCGCCAACCTGACATCCCTCTTCGCTGCGCAGGGACTATCCCAAAAGGACATGGTCGCGCTC
TCCG
GAGCCCATACCATTGGCCAAGCACGCTGCACCAACTTCAGGGCCCACGTCTACAATGACACCAACATCGATGGCGCCTTTGCAAGAACGAGGCAATCAGCATGTCCTCGAACCTCA
GGTTCAGGTGACAACAATTTGGCTCCTCTGGACCTTCAAACCCCAACCGCATTTGAGAACAACTACTACAAGAATCTTGTTTGCAAGAAGGGGCTTCTGCACTCTGACCAGGAGCTCTTC
AACGGTGGATCCACCGATGCACAAGTCCAATCATACGTTAGTAGCCAGAGCGCATTTTTCGCTGATTTTGTGACGGGCATGATCAAGATGGGTGGCATCACACCACTGACGGGCTCCAAC
GGGGAGATCAGGAAGAACTGCAGAAGGATTAACTAA

Retrieve as FASTA