Entry information : SiPrx119 (Si030304m)
Entry ID 9463
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx119 (Si030304m)
Name (synonym) SiPrx119 (Si030304m)
Class Class III peroxidase    [Orthogroup: Prx098]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx119
start..stop
S start..stop
SiPrx143 514 0 59..355 51..347
ZmPrx79 485 2e-173 59..355 66..362
SbPrx42 477 3e-170 59..355 65..360
HvPrx19 471 2e-168 60..355 31..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 46734425..46734597 173 N° 2 46734658..46735552 895  
join(46734425..46734597,46734658..46735552)


exon

Literature and cross-references SiPrx119 (Si030304m)
DNA ref. Phytozome 11:   scaffold_2 (46734425..46735552)
Protein sequence: SiPrx119 (Si030304m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   356 (333)
PWM (Da):   %s   37809.49 (35613.3) Transmb domain:   %s   i5-27o
PI (pH):   %s   8.89 (8.89) Peptide Signal:   %s   cut: 23 range:23-355
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSWLGVGVLILAALLGSATAQAGGYGYGGYPAKVAAAPSTAPEGAPAPPAVPAVPAFGFYRRSCPPAEHLVKLVVGKAIRNNPGVGAGLIRMAFHDCFVQGCDGSVLLDPTPANTRPEKLGPPNFPSLRGFEVIDAAKALLERYCPGVVSCADVVQFAARDAAFFLSGYKVNYRLPAGRFDGSISLENETLAFLPPSSFNLSELVQSFVAKGLDVDDLVVLSGSHSIGRSHCSSFSDRISTPPSDMDPGLATILKGQCPANPNITNDPTVVQDIVTPNRLDNQYYRNVLRRKVLFNSDATLLTSRETARKVVENAVVRGSWERKFARAMVKMSLIEIKNAANGEIRKNCRVVN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGCAGCTGGCTTGGCGTCGGCGTCCTGATCTTGGCTGCGCTGCTGGGCTCCGCGACGGCTCAAGCAGGTGGGTACGGCTATGGCGGGTATCCTGCAAAAGTTGCGGCAGCTCCA
AGCACGGCGCCGGAGGGTGCACCAGCACCACCCGCGGTCCCCGCGGTCCCCGC
GTATGCTCCAGTCCCACCGATGCAAACCCCTCCTCCCCCTGCGGCTGGTACGCCGCTCAGGTTCGGC
TTCTACCGGCGCTCGTGCCCCCCGGCGGAGCACCTCGTCAAGCTAGTCGTCGGCAAGGCGATCCGGAACAACCCTGGCGTCGGCGCCGGCCTCATCCGCATGGCCTTCCACGACTGCTTC
GTCCAGGGCTGTGACGGGTCCGTGCTGCTCGACCCGACGCCGGCGAACACGCGGCCGGAGAAGCTGGGCCCGCCCAACTTCCCCAGTCTGCGGGGCTTCGAGGTGATCGACGCGGCCAAG
GCGCTGCTCGAGAGGTACTGCCCCGGCGTCGTCTCCTGCGCCGACGTCGTCCAGTTCGCCGCCCGCGATGCCGCTTTCTTCCTCAGCGGCTACAAGGTCAACTACAGGCTCCCCGCGGGG
CGCTTCGACGGCAGCATCTCCTTGGAGAACGAGACGCTCGCCTTCCTGCCACCGTCCTCCTTCAACCTCTCCGAGCTCGTCCAAAGCTTCGTCGCCAAGGGCCTCGACGTCGACGACCTC
GTCGTGCTCTCCGGGTCCCACTCCATCGGCCGCTCCCACTGCTCCTCCTTCTCCGACCGTATCTCCACGCCGCCCTCCGACATGGACCCCGGCCTCGCCACCATCCTCAAGGGGCAGTGC
CCGGCGAACCCTAACATCACCAACGACCCCACGGTGGTGCAGGACATTGTCACCCCCAACAGGCTCGACAACCAGTACTACAGGAACGTGCTGAGGCGCAAGGTGCTCTTCAACTCCGAC
GCGACCCTGCTGACGTCGAGGGAGACGGCGAGGAAGGTGGTCGAGAACGCCGTCGTCCGCGGGAGCTGGGAGAGGAAGTTCGCCAGGGCCATGGTGAAGATGTCGCTCATCGAGATCAAG
AACGCCGCCAATGGCGAGATCAGGAAGAACTGCCGTGTCGTCAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGCAGCTGGCTTGGCGTCGGCGTCCTGATCTTGGCTGCGCTGCTGGGCTCCGCGACGGCTCAAGCAGGTGGGTACGGCTATGGCGGGTATCCTGCAAAAGTTGCGGCAGCTCCA
AGCACGGCGCCGGAGGGTGCACCAGCACCACCCGCGGTCCCCGCGGTCCCCGC
GTTCGGCTTCTACCGGCGCTCGTGCCCCCCGGCGGAGCACCTCGTCAAGCTAGTCGTCGGCAAGGCG
ATCCGGAACAACCCTGGCGTCGGCGCCGGCCTCATCCGCATGGCCTTCCACGACTGCTTCGTCCAGGGCTGTGACGGGTCCGTGCTGCTCGACCCGACGCCGGCGAACACGCGGCCGGAG
AAGCTGGGCCCGCCCAACTTCCCCAGTCTGCGGGGCTTCGAGGTGATCGACGCGGCCAAGGCGCTGCTCGAGAGGTACTGCCCCGGCGTCGTCTCCTGCGCCGACGTCGTCCAGTTCGCC
GCCCGCGATGCCGCTTTCTTCCTCAGCGGCTACAAGGTCAACTACAGGCTCCCCGCGGGGCGCTTCGACGGCAGCATCTCCTTGGAGAACGAGACGCTCGCCTTCCTGCCACCGTCCTCC
TTCAACCTCTCCGAGCTCGTCCAAAGCTTCGTCGCCAAGGGCCTCGACGTCGACGACCTCGTCGTGCTCTCCGGGTCCCACTCCATCGGCCGCTCCCACTGCTCCTCCTTCTCCGACCGT
ATCTCCACGCCGCCCTCCGACATGGACCCCGGCCTCGCCACCATCCTCAAGGGGCAGTGCCCGGCGAACCCTAACATCACCAACGACCCCACGGTGGTGCAGGACATTGTCACCCCCAAC
AGGCTCGACAACCAGTACTACAGGAACGTGCTGAGGCGCAAGGTGCTCTTCAACTCCGACGCGACCCTGCTGACGTCGAGGGAGACGGCGAGGAAGGTGGTCGAGAACGCCGTCGTCCGC
GGGAGCTGGGAGAGGAAGTTCGCCAGGGCCATGGTGAAGATGTCGCTCATCGAGATCAAGAACGCCGCCAATGGCGAGATCAGGAAGAACTGCCGTGTCGTCAACTAG

Retrieve as FASTA