Entry information : SiPrx120 (Si030339m)
Entry ID 9465
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx120 (Si030339m)
Name (synonym) SiPrx120 (Si030339m)
Class Class III peroxidase    [Orthogroup: Prx059]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx120
start..stop
S start..stop
CciPrx02 563 0 41..351 1..313
ZmPrx06 510 0 60..351 23..320
SbPrx46 504 0 58..351 20..319
TaPrx20-1A 478 3e-171 43..350 4..312
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 48178790..48179107 318 N° 2 48179355..48179534 180 N° 3 48179607..48179772 166 N° 4 48179876..48180267 392
join(48178790..48179107,48179355..48179534,48179607..48179772,48179876..48180267 )


exon

Literature and cross-references SiPrx120 (Si030339m)
DNA ref. Phytozome 12:   scaffold_2 (48178790..48180267)
Protein sequence: SiPrx120 (Si030339m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   352
PWM (Da):   %s   36462.34 Transmb domain:   %s   o10-32i37-59o
PI (pH):   %s   7.03
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MQLIAQHSTSISAAECLAPLLCVEAAIALLLLLVVRALLAMASSVSVLLLLCMAAVASAQLSPTFYDTSCPNALSTIKSAVTAAVKKENRMGASLLRLHFHDCFVQGCDASVLLDSGGEQGAIPNAGSLRGFNVIANIKAQVEAICKQTVSCADILAVAARDSVVALGGPSWTVPLGRRDSTSGSAALANSDLPPPFFNLSDLIGSFSNKGFSATEMVALSGAHTIGQAQCLNFRDHIYNDTNINAGFASSLKANCPRPTGNGDGNLAPLDTSTPYTFDNAYYSNLLSQKGLLHSDQELFNGGSTDNTVRNFASNKAAFSSAFAAAMVKMANLSPLTGSQGQIRLTCSKVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCTCATAGCACAGCATTCCACAAGCATCTCAGCAGCTGAGTGCCTTGCTCCTCTGCTCTGTGTAGAAGCTGCAATTGCACTGCTGCTTCTGCTTGTAGTACGTGCTCTGCTCGCC
ATGGCGTCTTCGGTTTCAGTCTTGCTGCTGCTCTGCATGGCCGCGGTGGCGTCGGCGCAGCTGTCGCCGACGTTCTACGACACGTCGTGCCCCAACGCGCTGTCCACCATCAAGAGCGCC
GTGACGGCCGCCGTGAAAAAGGAGAACCGGATGGGTGCCTCCTTGCTCAGGCTGCACTTCCATGACTGCTTTGTCCAG
GCAAGTTCGCCACTCACCTTCATATCATATGGCCTCACGTCT
TGCATGCACTTTATACGCACATCACCTAATGGCATCCCTGATGTGACAGTTTAGTTCCAATTTTCCGGCCACAGTCAATAACTCAGTTGAAGTCTAGTAGTTTGGGCATTCTAATTTAAC
TAAAGTCACAATAGGAACTGCCAAATTACTGGTGTCCACTCTCGACTCCATTCTAACAGAATCATCTGTATGCGTGTGACATCAGGGGTGCGACGCGTCCGTGCTGCTGGACAGCGGAGG
CGAGCAGGGGGCGATACCCAACGCGGGGTCGCTGAGGGGCTTCAACGTCATCGCCAACATCAAGGCGCAGGTGGAGGCCATCTGCAAGCAGACCGTGTCCTGCGCCGACATCCTCGCCGT
CGCCGCCCGCGACTCCGTTGTAGCG
GTAAGATGACGAACATTTGGCCATTTGGCCCTTCAGCTCATGCAATCGATTCATTCCTTTAATTTCGAGCAGTTGGGAGGGCCCTCATGGACGGT
TCCCTTGGGGCGGAGGGACTCCACAAGCGGGAGCGCGGCCCTGGCAAACAGCGACCTGCCGCCTCCCTTCTTCAACCTCAGCGACCTCATCGGCTCCTTCTCCAACAAGGGTTTCAGCGC
AACTGAAATGGTTGCGCTCTCTG
GTGCGTGCGGCTCTTAGCTTGTACACGATTATACCCTTCCTTTGTTTTCTTCAAGTGGCAACAAAAACTAAAGCTCCTTGCTTTGCGCCGCGCTTGC
ATGCAGGGGCGCACACGATCGGGCAGGCGCAGTGCCTCAACTTCAGGGACCACATCTACAACGACACCAACATCAACGCGGGCTTCGCGAGCTCGCTCAAGGCCAACTGCCCCCGGCCGA
CCGGCAACGGCGACGGCAACCTGGCGCCGCTCGACACATCGACGCCCTACACGTTCGACAACGCCTACTACAGCAACCTATTGAGCCAGAAGGGGCTCCTGCACTCCGACCAGGAGCTCT
TCAACGGTGGCAGCACGGACAACACCGTCAGGAACTTCGCTTCCAACAAGGCCGCCTTCAGCAGCGCCTTCGCCGCGGCCATGGTGAAGATGGCCAACCTCAGCCCGCTCACCGGCTCAC
AGGGACAGATCAGGCTCACCTGCTCCAAAGTGAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCAGCTCATAGCACAGCATTCCACAAGCATCTCAGCAGCTGAGTGCCTTGCTCCTCTGCTCTGTGTAGAAGCTGCAATTGCACTGCTGCTTCTGCTTGTAGTACGTGCTCTGCTCGCC
ATGGCGTCTTCGGTTTCAGTCTTGCTGCTGCTCTGCATGGCCGCGGTGGCGTCGGCGCAGCTGTCGCCGACGTTCTACGACACGTCGTGCCCCAACGCGCTGTCCACCATCAAGAGCGCC
GTGACGGCCGCCGTGAAAAAGGAGAACCGGATGGGTGCCTCCTTGCTCAGGCTGCACTTCCATGACTGCTTTGTCCAG
GGGTGCGACGCGTCCGTGCTGCTGGACAGCGGAGGCGAGCAG
GGGGCGATACCCAACGCGGGGTCGCTGAGGGGCTTCAACGTCATCGCCAACATCAAGGCGCAGGTGGAGGCCATCTGCAAGCAGACCGTGTCCTGCGCCGACATCCTCGCCGTCGCCGCC
CGCGACTCCGTTGTAGCG
TTGGGAGGGCCCTCATGGACGGTTCCCTTGGGGCGGAGGGACTCCACAAGCGGGAGCGCGGCCCTGGCAAACAGCGACCTGCCGCCTCCCTTCTTCAACCTC
AGCGACCTCATCGGCTCCTTCTCCAACAAGGGTTTCAGCGCAACTGAAATGGTTGCGCTCTCTG
GGGCGCACACGATCGGGCAGGCGCAGTGCCTCAACTTCAGGGACCACATCTACAAC
GACACCAACATCAACGCGGGCTTCGCGAGCTCGCTCAAGGCCAACTGCCCCCGGCCGACCGGCAACGGCGACGGCAACCTGGCGCCGCTCGACACATCGACGCCCTACACGTTCGACAAC
GCCTACTACAGCAACCTATTGAGCCAGAAGGGGCTCCTGCACTCCGACCAGGAGCTCTTCAACGGTGGCAGCACGGACAACACCGTCAGGAACTTCGCTTCCAACAAGGCCGCCTTCAGC
AGCGCCTTCGCCGCGGCCATGGTGAAGATGGCCAACCTCAGCCCGCTCACCGGCTCACAGGGACAGATCAGGCTCACCTGCTCCAAAGTGAACTAA

Retrieve as FASTA