Entry information : SiPrx121 (Si030393m)
Entry ID 9466
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2014-02-04 (Christophe Dunand)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2014-04-10 (Christophe Dunand)
Peroxidase information: SiPrx121 (Si030393m)
Name (synonym) SiPrx121 (Si030393m)
Class Class III peroxidase    [Orthogroup: Prx018]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx121
start..stop
S start..stop
ZmPrx10 598 0 5..328 7..330
SbPrx31 585 0 11..328 14..332
TmPrx07 560 0 22..343 22..343
TaPrx15 560 0 22..343 22..343
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 34102601..34102819 219 N° 2 34102961..34103152 192 N° 3 34105011..34105631 621  
join(34102601..34102819,34102961..34103152,34105011..34105631)


exon

Literature and cross-references SiPrx121 (Si030393m)
DNA ref. Phytozome 12:   scaffold_2 (34102601..34105631)
Protein sequence: SiPrx121 (Si030393m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   344 (320)
PWM (Da):   %s   37339.57 (34884.2)  
PI (pH):   %s   5.88 (5.87) Peptide Signal:   %s   cut: 24 range:24-343
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAARCGSLPLVAVLVALLCRAEAAVRELKVGYYAETCPEAEGIVREVMARARAREARSVASVMRLQFHDCFVNGCDGSVLMDATPTMPGEKDALSNINSLRSFEVVDEIKEALEERCPGVVSCADIVIMAARDAVVLTGGPSWEVRLGRDDSLTASQEDSDSIMPSPRANASALIRLFAGLNLSVTDLVALSGSHSIGEARCFSIVFRLYNQSGSGRPDPHMDAAYRCALDALCPKGGDEEVTGGMDATPRAFDNQYFKDLVALRGFLNSDQTLFSDNARTRRVVKRFSKDQNAFFRAFAEGMIKMGELQNPRKGEIRRNCRVANNSPATTPKEVAAYRVMDF*

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2)..
Promoter
Send to BLAST
Send to cis Analysis
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACCCTTC TATTTAGCAC TTCGTATCCA AACACCTATT GTATCGCTGC ACCAAAATAC AGAGAATAAG AGCTTTTATA TACGATGATA GGGAACATGA TAAGCTGCAT GGCGGCATGG  GCCAACAGTT TCTCATGTTT TTGCAAGTGG TAGGATATCA TTGCATATCA TGGGAATCAG GTTGACTAGG ATAAGATAAA GAATGAAAGC GACCGCATAC TAAATAATTA AATTTTCTCA  AGTTACTAGT AGTGCGGATG GAATATCTGC TGCTGCAAGC ATGCATGCAT ATGGTTCCCT TGTGGCCGGT CATGGATTGA GGGCCCAGGA AAGTGCGGGT CTTATTCTCG AGTCTAAAGA  GAACTGCAGT CCTGTCCTCG TTGGGCTGGG GGGTCCTACT TGGATTTTCT TGGTGGACGG CTGTTCGTTG CTATGTGTCT TGAGCTTGAG CTTCCTTTAC TTTTGTTTAC TTTGATAGTG  CAGTCTTCCA AGGTGTTGGT GAATTTTACG TATAAACAGA GGGGCCAAGT CTTACTCTAA AGTGGATCAT GGGCCAAGGA TTTTTTTTTA CAAATAGTGA GTTTAATACT TAAGGTCAAG  CAACACGAGA GAAGATTAAA ATCCCAAGTA ATCAAGAATA GGTGGGCAAG TGGCAGAGGT TGCAACACAT TAGATTCATA TTTAGGAGCA CGGATTACAT GTCACATGAA ACACTGCACT  AAAGTTAATT ACATTTACAA TGATTAGAGA TAGTACTAGC TCTATAAGAC TAATAATAGT GGATAGAGCA ATGAGGACTA GGCACAAAGA TTAGCATTGG TAAATCTAAT GATGATTTAT  GATGAGTGTA AATTTGCCTT TAATTATTTT ATGGTGTTAC GGCTCAACAC ATTAAATTCT CACAACGTTG AAAATTTAGC GAGCACATAC TTCCTCCCCC GTCAATATAG GATACTCTAT  TTTGGAAAAG TAAAACTTTG TAAATTTTGA CCAACAATGA GTCAAATTGT ATGCATGGGA GGGCTCCTCC CAAATCGTTT TAGGAGAAGC CAAAATCAGA AGGGAGAAAA ATGTGGCTTC  ACCCGCTCCT GATTTACCTT CTCATCGTTT CCCAAACCGA CTTCTTATTT ATAAAGCCAA AGCTAAAAAG AGTCGTGCAG AATGGATCCT CACTGTAAGT AACTTTCATA TTCAATAGTA  CTTCCAACGT GAGATCCCAC GTATCGACAT GCAATTAATC GTGTTTTACG AACCACAAGT GTTAGCGTGA AATACAACAC GAAAATGATG AATTGCGAGG ACATCTTTTT TTTTCACAAC  TCCATTCACC CCGTTCACAG CTTTGACTAG AATTAGAAGT CCCCATTGTT TTCACCTTTG CCCAAAATGT CATGAAAAAC CAGGGACACA GTGACACGGA GGCGCGCACA AAAGATGTCC  GGGTCAATGC TTCCCTCCTT CCCTGCCTGC CAATAGCCGG CCGTGCCGCC ATCACCCTCC ACCGCGACAC GGAGCACGAT CCGGGGCCGA TATTTTTGAC GCGCGCACGC GCAACCCAAC  GCGATCCCCG TGCGATCGAT GCCGTCGCGC CCGCGCGTGC TAGGGACGTG TGGGTGGGTG CAGGCCGCCA GGACGGCGCC GCGCGCACCC GGAGCCGACC CGGCCGGCCG CGCGTGCTCG  CGCCGTCCGC CCACCCACTG GCTGGCCACA GCTCCCCGCC GCGTCGCGCG AGGCCCGCGC CCCCGCCTCC CCAATCCCGT GGTGACAACC CATCGCCGCC ATGGGCCTCG GCCTGCAGCC  AGCGGCCAGC CCTCGTTTTC TATCTATCTG CAACAACCCG CCGGGGCGTC GCGGCTTGGA CGCTACTACT AGTACGCTGC CAAACAGCGG AGCAGAGCAA AGTGCAGCGC GGCGCAGTGC 
AGAGCGACCC CTCTCGGAGC AGAGCGTGCG CGCTTGCTCC ACCCCCTCCT CTCTCTCGTC TCTCCCCCGG TCTATCGAGC C 

Retrieve as FASTA  
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCCCGCTGCGGGAGCCTCCCCCTGGTCGCCGTGCTGGTCGCGTTGCTCTGCCGCGCCGAGGCGGCGGTGAGGGAGCTCAAGGTCGGGTACTACGCCGAGACGTGCCCGGAGGCC
GAGGGCATCGTCCGGGAGGTCATGGCGCGCGCGCGCGCCCGCGAGGCCCGCAGCGTCGCCTCCGTCATGCGCCTCCAGTTCCACGACTGCTTCGTCAAC
GTGAGTCGATCGCTCTACCCA
CGCATCTGATCTCGCCTTCGATTGCACCGCACGACGTGGTTTTTTTCTCCGCGACCGATCTGACGAGATGATGATGGATTCTCTAACCTCTGTTCCTCTTCGTTCCTCGCGAGGTTGCAG

GGGTGCGACGGGTCGGTGCTGATGGACGCCACGCCGACGATGCCCGGCGAGAAGGACGCGCTGTCCAACATCAACTCCCTGCGCTCGTTCGAGGTCGTCGACGAGATCAAGGAGGCGCTG
GAGGAGCGCTGCCCCGGCGTCGTCTCCTGCGCCGACATCGTCATCATGGCCGCCCGCGACGCCGTCGTCCTG
GTACGTGCCTGCGCCTTCCCTCCCCTTCCCCTCCCCTCCCCTGCCCCC
ACGACCCGCAGATCCATCGCGCCGCTCGCCTCGCTACGCGGTGGTGCCGACGCGCATGCCGTTTCTCTTCCGCGGCCAGCCGTTTCCCGTGAGAAATCCAGCGTCTCTACTCCGCTTTGT
CTGCCGTTTCCGGTCCGAATCCAGGGCTTCTACTCCGCTTTGTCTGCCGTTTCCAGTCCAGAATTCCTACTCCCTCCGCTGCCTGGCGTTTCCAGTGCAGAATTCCGCGTTGATCCTGCT
CCCCCAACATTAGTTTCAGTTTCAGGATCCACCGTGAGGACAAGACAAGAATATTGACTAGGAAAGCTTTTTCACGAATCTCTTTTACCACCACGGCAACGCTGCGCGCACGGGTACTTC
GTTTCAGCGTGGCCACCAACGCTCACCGTTGCGTCACCTGTGGACGCATTAGCCTTTCTGCCACTAGCCTGGCATTATTCTTCACTCCCCAAATCCAAAGTCACCGCGTCCTGACTAAAA
TCCACGTAGAAAACGAGCATCTGAGGATTTTCTGAGATATTTGGCGTGTGCCACCCCGTCACTTGCGTGTGTACACCACGGCTATGCATTCACGTTTATCTTCTTGGTGGAAACACACGC
TTCGGCGTCTCTCTAATCTCAAGCTTCTTTCGCATTTTACTTTTTATAGGAGATCGTTTGATGCTTTCCGAATTTACAGTAAAAATATTTCCTAGTACAAATTTTAGGGTGCAAATTGGC
AGCCTGATGACCATGTCACTTTGCCATTGATGAAAGCGATGCTAGCAATACATGGAGCCATAGAGATGCATGCACTCCAGGTCGCTGCTCCCTGTAACCACCGCAGCTGGGCGGGCAGGA
TGGCATCGCCATCACGCGCCCCCCATAGGCAGACAGCCAGGCCCAGTCAGGCGCATTTAACGGGGGCACGGGCGCGCAACCGAGCCGGGAAAGGCCAGGCCAGAGGGCCGCGCCCACGAG
GCCACGAAAGGCTACCCGCGAGCGACCCCGCCAGGGTGGGGCGGGTGGCGCGGCTAGATTGGTGTGGTGCACTGGTGGTAGGCTTCGGCGTCTAGCGCAGACAGCCCCGTACCGGGCCCG
TTGCTGCCACTGCCACTGGCGCCCCGCGAATGGCAAGGCCGCTGGCCCCGCCGCGCCGACGGGGTATTCTGTTTCTCTCGATCGAGTGATGATGGGAACGAGACTCCCGCCGGGCAGGGC
ACTTTTCCCGTGCTCCGTGCTCCCTTAGGAAGGTTCTCGGTACGCGTGTGCAGACAAGCGACGATGCCCGGGACGGAGTACGATGTCACTTTGTCACTATGCCAGTTGCCAGGGATACGA
ATTCTCTTCTTGTTCCCTTGGCGAGTTAACAGTCGACTGGTGGCTGCACTGAATTGGTTGATCGCTGATGCAGGAGATGTCACTCATAGCCATACCACCTACGCCTACGTTAATATTTTC
GCTAACGTCATCCTACAACATTCCCGTTACTTGTTCAGCTAGTGGGGTACTATTACAGGGTACAGGCTCTGTTGGTGTTTTCCTGTGACCAAATGAATGCAACAGGAAGATTGGTTCATC
AAAATGGCCGTAGTGCTACTAGTTGGATTGCAGTGTGCCACGCTGCAGACCTGCAGCGTCCGTTCACTCTGATTTTTGTTTAGTTTTTGTGAGGGAAAACGGCGCAGATCATATTAATAG
TATCAATCACTGTCAGTGAGAGTTTGCATTGCAATCTTTTTGCAGTACTAATACATGTCTGACCGATGAGTCAAAAAAAAGTGTTTCACTTGGATTGACCTCTTGATTTTGATTTGTTCT
CTTGCCACAGACCGGTGGGCCCAGCTGGGAGGTGCGGCTCGGGCGCGACGACAGCCTGACGGCGAGCCAGGAGGACTCGGACAGCATCATGCCGAGCCCGCGCGCCAACGCCAGCGCGCT
CATCCGCCTCTTCGCGGGGCTCAACCTCAGCGTCACCGACCTCGTCGCGCTCTCCGGCTCGCACTCCATCGGCGAGGCTCGCTGCTTCTCCATCGTCTTCCGCCTCTACAACCAGTCCGG
CTCCGGCCGCCCCGACCCCCACATGGACGCCGCCTACCGCTGCGCGCTCGACGCGCTCTGCCCCAAGGGCGGCGACGAGGAGGTCACGGGCGGCATGGACGCCACCCCGCGCGCCTTCGA
CAACCAGTACTTCAAGGACCTCGTCGCCCTCCGCGGCTTCCTCAACTCCGACCAGACGCTCTTCTCCGACAACGCCAGGACCCGCCGCGTCGTCAAGCGCTTCAGCAAGGACCAGAACGC
CTTCTTCAGGGCCTTCGCCGAGGGGATGATCAAGATGGGCGAGCTGCAGAACCCCAGGAAGGGGGAGATACGGCGTAACTGCCGCGTCGCCAACAACTCGCCGGCGACGACACCCAAGGA
GGTGGCGGCGTACCGCGTCATGGACTTCTGA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCCCGCTGCGGGAGCCTCCCCCTGGTCGCCGTGCTGGTCGCGTTGCTCTGCCGCGCCGAGGCGGCGGTGAGGGAGCTCAAGGTCGGGTACTACGCCGAGACGTGCCCGGAGGCC
GAGGGCATCGTCCGGGAGGTCATGGCGCGCGCGCGCGCCCGCGAGGCCCGCAGCGTCGCCTCCGTCATGCGCCTCCAGTTCCACGACTGCTTCGTCAAC
GGGTGCGACGGGTCGGTGCTG
ATGGACGCCACGCCGACGATGCCCGGCGAGAAGGACGCGCTGTCCAACATCAACTCCCTGCGCTCGTTCGAGGTCGTCGACGAGATCAAGGAGGCGCTGGAGGAGCGCTGCCCCGGCGTC
GTCTCCTGCGCCGACATCGTCATCATGGCCGCCCGCGACGCCGTCGTCCTG
ACCGGTGGGCCCAGCTGGGAGGTGCGGCTCGGGCGCGACGACAGCCTGACGGCGAGCCAGGAGGACTCG
GACAGCATCATGCCGAGCCCGCGCGCCAACGCCAGCGCGCTCATCCGCCTCTTCGCGGGGCTCAACCTCAGCGTCACCGACCTCGTCGCGCTCTCCGGCTCGCACTCCATCGGCGAGGCT
CGCTGCTTCTCCATCGTCTTCCGCCTCTACAACCAGTCCGGCTCCGGCCGCCCCGACCCCCACATGGACGCCGCCTACCGCTGCGCGCTCGACGCGCTCTGCCCCAAGGGCGGCGACGAG
GAGGTCACGGGCGGCATGGACGCCACCCCGCGCGCCTTCGACAACCAGTACTTCAAGGACCTCGTCGCCCTCCGCGGCTTCCTCAACTCCGACCAGACGCTCTTCTCCGACAACGCCAGG
ACCCGCCGCGTCGTCAAGCGCTTCAGCAAGGACCAGAACGCCTTCTTCAGGGCCTTCGCCGAGGGGATGATCAAGATGGGCGAGCTGCAGAACCCCAGGAAGGGGGAGATACGGCGTAAC
TGCCGCGTCGCCAACAACTCGCCGGCGACGACACCCAAGGAGGTGGCGGCGTACCGCGTCATGGACTTCTGA

Retrieve as FASTA