Entry information : SiPrx138 (Si031937m)
Entry ID 9479
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-12-14 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-07 (Qiang Li)
Peroxidase information: SiPrx138 (Si031937m)
Name (synonym) SiPrx138 (Si031937m)
Class Class III peroxidase    [Orthogroup: Prx143]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx138
start..stop
S start..stop
SiPrx176 709 0 1..350 1..350
SbPrx44 524 0 14..350 19..349
SiPrx141 520 0 35..350 45..360
SiPrx140 513 0 1..350 1..345
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 46817488..46817769 282 N° 2 46817887..46818657 771  
join(46817488..46817769,46817887..46818657)


exon

Literature and cross-references SiPrx138 (Si031937m)
DNA ref. Phytozome 12:   scaffold_2 (46817488..46818657)
Protein sequence: SiPrx138 (Si031937m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   350 (329)
PWM (Da):   %s   36158.24 (34026.1)  
PI (pH):   %s   8.04 (7.98) Peptide Signal:   %s   cut: 22 range:22-350
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARLAAVTLLALLCSVTCCQASGYGYGYPGSGGGYPSPAPTPTPSGTGLAVGFYSHTCPNAEAIVRGVVKKAVEQNPGVGAGLIRMLFHDCFVQGCDASVLLDPTAANPQPEKLSPPNFPSLRGFEVIDAAKAALEAACSGTVSCADIVAFAGRDASAVLSGGRADFAMPAGRRDGRVSRSDEALQFLPPPSFNLSELTASFAAKGLDVSDLVVLSGAHTVGRSHCSSFIVTDGRLNASTSDMNPALAASLRRQCPAAPTAANDPTVVQDVVTPARLDSQYYKNVLNRNVLFTSDAALLKSGQTAASVVLNAFVPGLWEQKFARAMVKMASIEVKTGANGEIRRNCRIVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGGCTTGCCGCTGTGACCTTGCTTGCGCTGCTGTGCTCGGTGACATGCTGCCAAGCTTCAGGCTATGGCTACGGCTACCCTGGCTCGGGAGGGGGCTACCCCAGCCCGGCCCCA
ACCCCGACACCGAGTGGCACCGGCCTGGCGGTTGGCTTCTACAGTCACACGTGCCCGAACGCCGAGGCGATCGTGAGAGGCGTCGTCAAGAAGGCGGTGGAGCAGAACCCAGGCGTCGGG
GCAGGGCTCATCCGAATGCTCTTCCACGACTGCTTCGTCCAG
GTACGTACATGCATGCTGTGCATGTTCATCAGTGTTCTCTTCGGTACTTCACGTGCTACCATGCATTCGCTGCATGCT
TAACAATTCTGCACATGGAACAACGTGTTTGTGGTTCAGGGCTGTGACGCGTCCGTGCTGCTCGACCCGACCGCGGCGAACCCGCAGCCGGAGAAGCTGTCCCCACCCAACTTCCCGAGC
CTGCGCGGATTCGAGGTCATCGACGCGGCCAAGGCGGCGCTCGAGGCCGCCTGCTCGGGCACGGTCTCCTGCGCCGACATCGTCGCCTTCGCCGGCCGCGACGCCAGCGCCGTGCTCAGC
GGCGGCCGGGCCGACTTCGCCATGCCCGCGGGCCGCCGCGACGGCCGCGTGTCCCGCTCCGACGAGGCGCTTCAGTTCCTTCCCCCGCCCTCCTTCAACCTCTCCGAGCTCACCGCCAGC
TTCGCCGCCAAGGGGCTCGACGTCAGCGACCTCGTCGTGCTCTCCGGCGCCCACACCGTCGGCCGCTCCCACTGCTCGTCCTTCATCGTCACCGACGGCCGCCTCAACGCGTCCACGTCC
GACATGAACCCGGCGCTGGCCGCGTCGCTGCGGCGCCAGTGCCCGGCCGCCCCGACCGCGGCCAACGACCCCACCGTGGTGCAGGACGTGGTGACGCCGGCCAGGCTGGACAGCCAGTAC
TACAAGAACGTGCTGAACCGCAACGTGCTGTTCACGTCGGACGCGGCGCTCCTCAAGTCGGGGCAGACGGCGGCGTCGGTGGTGCTGAACGCGTTCGTGCCGGGGCTGTGGGAGCAGAAG
TTTGCCAGGGCCATGGTGAAGATGGCCAGCATCGAGGTCAAGACCGGCGCCAACGGCGAGATCAGGAGGAACTGCAGGATCGTCAACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGGCTTGCCGCTGTGACCTTGCTTGCGCTGCTGTGCTCGGTGACATGCTGCCAAGCTTCAGGCTATGGCTACGGCTACCCTGGCTCGGGAGGGGGCTACCCCAGCCCGGCCCCA
ACCCCGACACCGAGTGGCACCGGCCTGGCGGTTGGCTTCTACAGTCACACGTGCCCGAACGCCGAGGCGATCGTGAGAGGCGTCGTCAAGAAGGCGGTGGAGCAGAACCCAGGCGTCGGG
GCAGGGCTCATCCGAATGCTCTTCCACGACTGCTTCGTCCAG
GGCTGTGACGCGTCCGTGCTGCTCGACCCGACCGCGGCGAACCCGCAGCCGGAGAAGCTGTCCCCACCCAACTTCCCG
AGCCTGCGCGGATTCGAGGTCATCGACGCGGCCAAGGCGGCGCTCGAGGCCGCCTGCTCGGGCACGGTCTCCTGCGCCGACATCGTCGCCTTCGCCGGCCGCGACGCCAGCGCCGTGCTC
AGCGGCGGCCGGGCCGACTTCGCCATGCCCGCGGGCCGCCGCGACGGCCGCGTGTCCCGCTCCGACGAGGCGCTTCAGTTCCTTCCCCCGCCCTCCTTCAACCTCTCCGAGCTCACCGCC
AGCTTCGCCGCCAAGGGGCTCGACGTCAGCGACCTCGTCGTGCTCTCCGGCGCCCACACCGTCGGCCGCTCCCACTGCTCGTCCTTCATCGTCACCGACGGCCGCCTCAACGCGTCCACG
TCCGACATGAACCCGGCGCTGGCCGCGTCGCTGCGGCGCCAGTGCCCGGCCGCCCCGACCGCGGCCAACGACCCCACCGTGGTGCAGGACGTGGTGACGCCGGCCAGGCTGGACAGCCAG
TACTACAAGAACGTGCTGAACCGCAACGTGCTGTTCACGTCGGACGCGGCGCTCCTCAAGTCGGGGCAGACGGCGGCGTCGGTGGTGCTGAACGCGTTCGTGCCGGGGCTGTGGGAGCAG
AAGTTTGCCAGGGCCATGGTGAAGATGGCCAGCATCGAGGTCAAGACCGGCGCCAACGGCGAGATCAGGAGGAACTGCAGGATCGTCAACTAG

Retrieve as FASTA