Entry information : SiPrx149 (Si036462m)
Entry ID 9491
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx149 (Si036462m)
Name (synonym) SiPrx149 (Si036462m)
Class Class III peroxidase    [Orthogroup: Prx069]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx149
start..stop
S start..stop
SiPrx147 552 0 26..342 25..341
SiPrx152 540 0 25..342 24..336
SiPrx150 537 0 25..342 20..338
ZmPrx34 528 0 26..342 26..337
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 34358327..34358566 240 N° 2 34358692..34358883 192 N° 3 34360740..34360902 163 N° 4 34361114..34361544 431
join(34358327..34358566,34358692..34358883,34360740..34360902,34361114..34361544 )


exon

Literature and cross-references SiPrx149 (Si036462m)
DNA ref. Phytozome 11:   scaffold_9 (34358327..34361544)
Protein sequence: SiPrx149 (Si036462m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   343 (310)
PWM (Da):   %s   36769.57 (33559.0) Transmb domain:   %s   o10-32i
PI (pH):   %s   4.29 (4.16) Peptide Signal:   %s   cut: 33 range:33-342
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASSHSPRSASGATAVMAVLFVAALCLHGAMAQPLREDYYDGTCPDAYNIVKQVLIDAHESDERIYASLIRLHFHDCFVQGCDGSILLDNMTGMQSEKESPPNNGSARGYEVVDAVKCALEDACPGVVSCADILAIAAEISVELSGGPSWGVLLGRLDGRTSDFNGSQDLPAPFENLTTLQSKFQAVGLNDVDLVALSGAHTFGRVQCANVADQPADRLYNFSGTNMPDPTLDSAYRAFLSQRCPRNGDSSVLNDLDPTTPDTFDNHYYTNIEVNRGFLTSDQELKSAPEAQGTTAPIVDQFASSQDAFFASFAQSMINMGNIRPVTDPSQGEVRTNCRRIN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCTCCCATTCTCCTCGTTCTGCCTCCGGCGCCACCGCCGTCATGGCCGTGCTGTTTGTGGCGGCCCTGTGCCTGCACGGCGCCATGGCGCAACCGCTGCGCGAGGACTACTAC
GACGGCACGTGCCCTGACGCCTATAACATCGTGAAGCAGGTGCTCATCGACGCGCACGAGTCGGACGAGCGCATCTACGCCAGCCTCATCCGCCTCCACTTCCACGATTGCTTCGTCCAA
GTAACCTTCCTCTTCTCTCTGCTAGGCCGCCATGCCCGTGCCCGTGCCCATGCGTGATCATGCAGCATTCACGATGCATTATTGTTTCATTGGTGAGTGTGGTGATGACCGTTTATTGTT
CATAGGGCTGCGACGGGTCGATTCTGCTGGACAACATGACAGGGATGCAGTCCGAGAAGGAGTCACCGCCCAACAACGGCTCGGCGCGCGGGTACGAGGTGGTGGACGCCGTCAAGTGCG
CGCTGGAGGACGCCTGCCCTGGCGTCGTCTCCTGCGCCGACATCCTCGCTATCGCCGCGGAGATCTCCGTCGAGCTG
GTACGTACCCGCGGCTGCCTAGATACAACCTAGCTTCATGGCA
TACTATACTACCATTGTGATCATTGATGGACGTAGTCACGTAGCGGCAGGTGCGCGGTAGCTTTCGATGAGGGTTGAGGGGCATGCATGAATCTTGATTTGACCGTCAACAACATGCTAT
AACTTTATTGACACCATTTAAAAATTATAGGGAAAAAATGATTGCGTAGACATGTCGGTGCATTCATGCAAACCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNTTTGAGTTTATTTGAAATTGAAAAATATTTGAAAAAGACTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCCCTTATCCGTTCTCTAC
TCTGGCTCCCATCTATCTGCTTTGGTCAGTCATCATCCTCTTTCTCCATCTTCCCCGCAAGCTGCCGCCCCTCCGTCCCTCCATCCCAGCCTCGCCATGCTGCTTCCCATGTTGCTGCTC
CACCTCGCTGTGCCGCTTCCCCATGCTGTGCTGCATGCTCCTGCCATTGCTCCCCTGCCCAAGCGCGCAGGGCCACGGCTAAGGCATGAATGGCAGGCGGCGTGCTCCCGCCAGCGGGTC
GACGGTGGCGAGTGGCGTGCTCGCGCCGACGGGTCGGTTGTTGCGGGCGGCACGCCCGCTCTAGCCATGGAAGGTGCAGCTGGCCTCAATCATCGGCAAGCCTAAAGCCTTCAACCTCTA
GGTACAACACGATTTTGGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGCTCAAGA
GAGCTAGTATTGCGGGGCTTCTTTGGTGGAACTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAACTTCCCATGTCCTTTCGTCA
ATATATATGTCCATTACGTTTGGTTCGGTACTAATGCGCGAAATAAGTACCGGGTCCAAATTATCAGTCCTCGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGCGATACNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGGCCTCCTAGCTGTTCGTGAATTTTTTCATTATTTTTTGGACACAAATGTTGCATTTAATACTGGGTATTTTGGTCGGTAC
TAAATGACATGACATTTAGTACCGAAGAAGTGATACTAGTGGCGCTGGTACTAAAGGGTTCCGACCGATAATAGCTGGAAGTCAATCCTCCAGTAGTGTTCAATGATTTACACATGGTAG
TATGGGAAGTAGCTAGCTACTGGCCACAGCTTACGTGTCTACATGAGCAGACGATTAATGTACAGAAAAGCTGCTAGAAATATTGACACGTAAATATTGATTTATAGCTAATCTGCTCGT
CCATAACATGCAGTCGGGAGGACCCAGCTGGGGTGTACTCCTGGGAAGACTGGACGGCAGAACGTCAGACTTCAACGGCTCCCAGGACCTGCCGGCGCCCTTCGAAAATCTCACCACGCT
CCAGAGTAAGTTCCAAGCCGTCGGCCTTAACGACGTCGACCTCGTCGCCCTCTCAG
GTACGCGCGTGAACAATAGTTGGCATATATTCTACGTCGAATTTTCTAAATGTATAGATAGAAA
ATTCTATGTACATAGTAAAGTCTATGTACCTAGAAAAACTCAGACAACCTACATTTTATACTACATTTTGTAAAGGAGCATCACACTATTGCTCTGACCAACGTTAACGCCCCATCTGTT
TCTCTTGAATGCATGTGACCCACACAGGGGCTCACACGTTTGGCAGGGTACAATGTGCAAACGTCGCCGACCAACCGGCCGACCGGCTCTACAACTTCAGCGGCACCAACATGCCGGACC
CGACCCTGGACTCGGCTTACCGAGCATTCCTATCGCAGAGGTGCCCGAGGAATGGCGACAGTTCGGTCTTGAACGACCTCGATCCAACGACGCCGGACACCTTCGACAACCACTACTACA
CCAACATCGAAGTGAACCGGGGGTTCCTCACCTCCGATCAGGAGCTCAAGTCCGCACCCGAAGCGCAGGGCACCACGGCACCGATTGTCGATCAGTTCGCGAGCAGCCAGGATGCCTTCT
TTGCTAGTTTTGCACAGTCCATGATCAACATGGGGAACATAAGGCCAGTGACGGATCCATCCCAAGGGGAAGTCAGGACAAACTGCAGAAGGATCAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTTCCTCCCATTCTCCTCGTTCTGCCTCCGGCGCCACCGCCGTCATGGCCGTGCTGTTTGTGGCGGCCCTGTGCCTGCACGGCGCCATGGCGCAACCGCTGCGCGAGGACTACTAC
GACGGCACGTGCCCTGACGCCTATAACATCGTGAAGCAGGTGCTCATCGACGCGCACGAGTCGGACGAGCGCATCTACGCCAGCCTCATCCGCCTCCACTTCCACGATTGCTTCGTCCAA
GGCTGCGACGGGTCGATTCTGCTGGACAACATGACAGGGATGCAGTCCGAGAAGGAGTCACCGCCCAACAACGGCTCGGCGCGCGGGTACGAGGTGGTGGACGCCGTCAAGTGCGCGCTG
GAGGACGCCTGCCCTGGCGTCGTCTCCTGCGCCGACATCCTCGCTATCGCCGCGGAGATCTCCGTCGAGCTG
TCGGGAGGACCCAGCTGGGGTGTACTCCTGGGAAGACTGGACGGCAGA
ACGTCAGACTTCAACGGCTCCCAGGACCTGCCGGCGCCCTTCGAAAATCTCACCACGCTCCAGAGTAAGTTCCAAGCCGTCGGCCTTAACGACGTCGACCTCGTCGCCCTCTCAG
GGGCT
CACACGTTTGGCAGGGTACAATGTGCAAACGTCGCCGACCAACCGGCCGACCGGCTCTACAACTTCAGCGGCACCAACATGCCGGACCCGACCCTGGACTCGGCTTACCGAGCATTCCTA
TCGCAGAGGTGCCCGAGGAATGGCGACAGTTCGGTCTTGAACGACCTCGATCCAACGACGCCGGACACCTTCGACAACCACTACTACACCAACATCGAAGTGAACCGGGGGTTCCTCACC
TCCGATCAGGAGCTCAAGTCCGCACCCGAAGCGCAGGGCACCACGGCACCGATTGTCGATCAGTTCGCGAGCAGCCAGGATGCCTTCTTTGCTAGTTTTGCACAGTCCATGATCAACATG
GGGAACATAAGGCCAGTGACGGATCCATCCCAAGGGGAAGTCAGGACAAACTGCAGAAGGATCAAC

Retrieve as FASTA