Entry information : SiPrx15 (Si002126m)
Entry ID 9492
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx15 (Si002126m)
Name (synonym) SiPrx15 (Si002126m)
Class Class III peroxidase    [Orthogroup: Prx001]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx15
start..stop
S start..stop
SiPrx14 630 0 1..338 1..338
SbPrx53 611 0 1..338 1..336
SiPrx17 611 0 3..337 2..334
SbPrx54 603 0 4..334 3..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4679104..4679340 237 N° 2 4677900..4678676 777  
complement(join(4677900..4678676,4679104..4679340))


exon

Literature and cross-references SiPrx15 (Si002126m)
DNA ref. Phytozome 12:   scaffold_5 (4679340..4677900)
Protein sequence: SiPrx15 (Si002126m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   339
PWM (Da):   %s   36004.52 Transmb domain:   %s   i7-29o
PI (pH):   %s   8.86
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAASKRGCLVLLCLAVVAPLLLAGGVHGHPWGGLFPQFYDHSCPKAKEIVKSIVAQAVARETRMAASLVRLHFHDCFVKGCDASVLLDNSTGIVSEKGSNPNKNSLRGFEVVDEIKAALEAACPGTVSCADVLALAARDSTVLAGGPYWDVPLGRRDSLGASIQGSNNDIPAPNNTLPTIVTKFRRQGLDVADVVALSGAHTIGLSRCTSFRQRLYNQTGNGLADATLDASFAARLRQGCPRSGGDNNLFPLDLATPARFDNLYFRNILAGKGLLSSDEVLLTKSAETAALVKAYAADVDLFFQHFARSMVRMGNISPLTGAQGEVRKNCRRLNGNRY*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCTTCCAAGCGTGGTTGCCTCGTCCTGCTATGCCTCGCCGTCGTCGCTCCCCTCCTCCTCGCCGGCGGCGTCCATGGCCACCCGTGGGGCGGCCTGTTCCCGCAGTTCTACGAC
CACTCGTGCCCCAAGGCGAAGGAGATCGTGAAGTCCATCGTGGCGCAGGCCGTCGCCAGGGAGACCAGGATGGCGGCGTCGCTCGTCAGGCTGCATTTCCATGACTGCTTCGTCAAG
GTA
CGTGAACTCTCTGCTGTAATTTTCGTTACATGCATGCTTTGGCACGGCTGTCATGCTTGCTAAGCACATAGCTCCAAATGCAGAGTGCACAACTGGAAACTTTTGGTATTGGAAGAGGTA
GCATGGAGGAATCTGTAAAATTTTACCAATGATAAGATGGCCTACCAATATTGCGCATGCCAACGCTACTTTACCTTATGTCTTGGTGGCATCATGTCTTGGTGCACTGCCGATGATTGT
TTTTTTTCCCTTTTTCTGAAAAAGAAAATGATTACTTACCTCAAACTCAAAATAATTGACGCAAGTTCTTCATATGCAATAATATTTTTTATCATCCACTCAATGCATGTGCCTAATGAG
TGTTACCACACCGTTGTCATGGCACGTACCAACTTTTTGCGACACTTTTCTGTCCTGCCTGCAGGGTTGCGACGCCTCGGTGCTTCTGGACAACAGCACCGGCATCGTGAGCGAGAAAGG
GTCCAACCCCAACAAGAACTCCCTCCGGGGGTTCGAGGTGGTGGACGAGATCAAGGCCGCCCTGGAGGCCGCCTGCCCCGGCACCGTCTCCTGCGCCGACGTCCTCGCCCTCGCCGCCCG
CGACTCCACCGTCCTCGCCGGCGGGCCCTACTGGGACGTCCCGCTGGGGCGGCGCGACTCGCTGGGCGCCAGCATCCAGGGCTCCAACAACGACATCCCGGCGCCCAACAACACCCTCCC
CACCATCGTCACCAAGTTCCGGCGCCAGGGCCTCGACGTCGCCGACGTCGTCGCGCTCTCCGGCGCCCACACCATCGGCCTCTCCCGCTGCACCAGCTTCCGGCAGCGGCTGTACAACCA
GACGGGCAACGGCTTGGCCGACGCCACGCTGGACGCGTCCTTCGCGGCGCGGCTCCGGCAGGGGTGCCCGCGCTCCGGCGGCGACAACAACCTCTTCCCGCTGGACCTCGCCACCCCGGC
CAGGTTCGACAACCTCTACTTCAGGAACATCCTGGCCGGGAAGGGCCTCCTCAGCTCCGACGAGGTGCTGCTGACCAAGAGCGCCGAGACGGCGGCGCTCGTGAAGGCCTACGCCGCCGA
CGTCGACCTCTTCTTCCAGCACTTCGCGCGGTCGATGGTGAGGATGGGCAACATCTCGCCGCTGACCGGCGCGCAGGGGGAGGTCAGGAAGAACTGCAGGAGGCTGAACGGCAACCGCTA
C

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCTTCCAAGCGTGGTTGCCTCGTCCTGCTATGCCTCGCCGTCGTCGCTCCCCTCCTCCTCGCCGGCGGCGTCCATGGCCACCCGTGGGGCGGCCTGTTCCCGCAGTTCTACGAC
CACTCGTGCCCCAAGGCGAAGGAGATCGTGAAGTCCATCGTGGCGCAGGCCGTCGCCAGGGAGACCAGGATGGCGGCGTCGCTCGTCAGGCTGCATTTCCATGACTGCTTCGTCAAG
GGT
TGCGACGCCTCGGTGCTTCTGGACAACAGCACCGGCATCGTGAGCGAGAAAGGGTCCAACCCCAACAAGAACTCCCTCCGGGGGTTCGAGGTGGTGGACGAGATCAAGGCCGCCCTGGAG
GCCGCCTGCCCCGGCACCGTCTCCTGCGCCGACGTCCTCGCCCTCGCCGCCCGCGACTCCACCGTCCTCGCCGGCGGGCCCTACTGGGACGTCCCGCTGGGGCGGCGCGACTCGCTGGGC
GCCAGCATCCAGGGCTCCAACAACGACATCCCGGCGCCCAACAACACCCTCCCCACCATCGTCACCAAGTTCCGGCGCCAGGGCCTCGACGTCGCCGACGTCGTCGCGCTCTCCGGCGCC
CACACCATCGGCCTCTCCCGCTGCACCAGCTTCCGGCAGCGGCTGTACAACCAGACGGGCAACGGCTTGGCCGACGCCACGCTGGACGCGTCCTTCGCGGCGCGGCTCCGGCAGGGGTGC
CCGCGCTCCGGCGGCGACAACAACCTCTTCCCGCTGGACCTCGCCACCCCGGCCAGGTTCGACAACCTCTACTTCAGGAACATCCTGGCCGGGAAGGGCCTCCTCAGCTCCGACGAGGTG
CTGCTGACCAAGAGCGCCGAGACGGCGGCGCTCGTGAAGGCCTACGCCGCCGACGTCGACCTCTTCTTCCAGCACTTCGCGCGGTCGATGGTGAGGATGGGCAACATCTCGCCGCTGACC
GGCGCGCAGGGGGAGGTCAGGAAGAACTGCAGGAGGCTGAACGGCAACCGCTAC

Retrieve as FASTA