Entry information : SiPrx153 (Si036541m)
Entry ID 9496
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx153 (Si036541m)
Name (synonym) SiPrx153 (Si036541m)
Class Class III peroxidase    [Orthogroup: Prx023]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx153
start..stop
S start..stop
ZmPrx13 548 0 28..332 28..334
SbPrx19 547 0 1..332 1..332
BdiPrx45 520 0 4..332 2..334
OsPrx38 495 4e-178 1..332 1..335
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 51832290..51832526 237 N° 2 51832626..51832808 183 N° 3 51832932..51833097 166 N° 4 51833245..51833654 410
join(51832290..51832526,51832626..51832808,51832932..51833097,51833245..51833654 )


exon

Literature and cross-references SiPrx153 (Si036541m)
DNA ref. Phytozome 12:   scaffold_9 (51832290..51833654)
Protein sequence: SiPrx153 (Si036541m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   333 (300)
PWM (Da):   %s   34658.18 (31258.5) Transmb domain:   %s   i13-30o
PI (pH):   %s   5.66 (5.34) Peptide Signal:   %s   cut: 33 range:33-332
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEHNYSCSRDVNCLAALLLAALCLGAAVVARGQLTDDFYDDCCPQAEDIVKARVSAAMKAEARMGASLLRLHFHDCFVNGCDGSILLDGSNSEKLAGPNLNSARGFEVVDAIKADLEKACPGVVSCADVLALAAKYGVLLSGGPDYDVLLGRRDGLVANQSGANSNLPGPFDPISDIIKKFRDVGLNTTDVVVLSGGHTIGRGRCTLFSNRLSNFSATSSVDPTLDSSLASSLQALCRGGDGNQTAALDAGSADAFDNHYFQNLLSQKGLLSSDQGLFSGAGANATKALVQLYGANSERFLCDFGRSMVKMGNILPLTGSAGQIRKNCRAVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCACAACTACTCCTGCAGCAGAGACGTGAACTGCCTGGCGGCCCTGCTGCTCGCCGCGCTGTGCCTGGGCGCCGCCGTGGTGGCGCGGGGCCAGCTGACGGACGACTTCTACGAC
GACTGCTGCCCGCAGGCGGAGGACATCGTCAAGGCGCGCGTGTCCGCCGCGATGAAGGCCGAGGCCCGCATGGGCGCCTCCCTGCTCAGGCTCCACTTCCACGACTGCTTCGTCAAC
GTA
CGTGCCCCCACTCGATCTTCAGGTTCATGACTATTATTATGTACGTACTGCTGGTCACTGAAAAAGACTTGGCTGCACTGCATGGACACGTTGCAGGGTTGCGACGGGTCCATCCTGCTG
GACGGGAGCAACAGCGAGAAGCTGGCGGGGCCGAACCTGAACTCGGCCAGGGGGTTCGAGGTCGTCGACGCCATCAAGGCCGACCTCGAGAAGGCGTGCCCGGGGGTCGTCTCCTGCGCC
GACGTCCTCGCCCTCGCCGCCAAGTACGGAGTGTTGCTG
GTACGTCGTCCCTCTTCTTCCCAATCTCGACTGAACATTCGCACAGTTAGTGCTTCAGTGGTCAAGCAGCCATCGAGTGAT
CACGTACGCTCGCTGAAAACATACGACGTATTATTTCTTCAGAGCGGTGGGCCGGACTACGACGTCCTGCTGGGCAGGAGGGACGGCCTGGTGGCGAACCAGTCCGGTGCTAACAGCAAC
CTGCCTGGACCGTTCGACCCCATCAGCGACATCATAAAGAAGTTCAGGGACGTGGGTCTGAACACAACCGACGTGGTCGTTTTATCAG
GTACTTGGCTCCATTTCCAGCTTCCACGCACC
CAATTTCACAGCTAGCTGCACAATACTCTCGATCGTTCATGCCAAAGCCTGATGCCTGGACGAGTGGACGTGTCAATTGACCCGATATTCATGACGGCCATGAACACTTACGCAGGAGGC
CACACGATCGGCCGGGGGCGGTGCACGCTGTTCAGCAACCGGCTGTCCAACTTCTCGGCGACGAGCTCCGTGGACCCGACGCTGGACTCGTCCCTGGCGTCCAGCCTGCAAGCCCTCTGC
CGGGGCGGGGACGGCAACCAGACGGCGGCGCTGGACGCCGGCTCCGCGGACGCGTTCGACAACCACTACTTCCAGAACCTGCTCAGCCAGAAGGGCCTCCTGTCCTCCGACCAGGGCCTC
TTCTCCGGCGCCGGCGCCAACGCCACCAAGGCGCTCGTGCAGCTCTACGGCGCCAACAGCGAGCGCTTCCTCTGCGACTTCGGCCGCTCCATGGTCAAGATGGGCAACATCCTCCCCCTC
ACCGGCTCCGCCGGCCAGATCCGCAAGAACTGCCGCGCCGTCAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAGCACAACTACTCCTGCAGCAGAGACGTGAACTGCCTGGCGGCCCTGCTGCTCGCCGCGCTGTGCCTGGGCGCCGCCGTGGTGGCGCGGGGCCAGCTGACGGACGACTTCTACGAC
GACTGCTGCCCGCAGGCGGAGGACATCGTCAAGGCGCGCGTGTCCGCCGCGATGAAGGCCGAGGCCCGCATGGGCGCCTCCCTGCTCAGGCTCCACTTCCACGACTGCTTCGTCAAC
GGT
TGCGACGGGTCCATCCTGCTGGACGGGAGCAACAGCGAGAAGCTGGCGGGGCCGAACCTGAACTCGGCCAGGGGGTTCGAGGTCGTCGACGCCATCAAGGCCGACCTCGAGAAGGCGTGC
CCGGGGGTCGTCTCCTGCGCCGACGTCCTCGCCCTCGCCGCCAAGTACGGAGTGTTGCTG
AGCGGTGGGCCGGACTACGACGTCCTGCTGGGCAGGAGGGACGGCCTGGTGGCGAACCAG
TCCGGTGCTAACAGCAACCTGCCTGGACCGTTCGACCCCATCAGCGACATCATAAAGAAGTTCAGGGACGTGGGTCTGAACACAACCGACGTGGTCGTTTTATCAG
GAGGCCACACGATC
GGCCGGGGGCGGTGCACGCTGTTCAGCAACCGGCTGTCCAACTTCTCGGCGACGAGCTCCGTGGACCCGACGCTGGACTCGTCCCTGGCGTCCAGCCTGCAAGCCCTCTGCCGGGGCGGG
GACGGCAACCAGACGGCGGCGCTGGACGCCGGCTCCGCGGACGCGTTCGACAACCACTACTTCCAGAACCTGCTCAGCCAGAAGGGCCTCCTGTCCTCCGACCAGGGCCTCTTCTCCGGC
GCCGGCGCCAACGCCACCAAGGCGCTCGTGCAGCTCTACGGCGCCAACAGCGAGCGCTTCCTCTGCGACTTCGGCCGCTCCATGGTCAAGATGGGCAACATCCTCCCCCTCACCGGCTCC
GCCGGCCAGATCCGCAAGAACTGCCGCGCCGTCAAC

Retrieve as FASTA