Entry information : SiPrx158 (Si036586m)
Entry ID 9501
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx158 (Si036586m)
Name (synonym) SiPrx158 (Si036586m)
Class Class III peroxidase    [Orthogroup: Prx019]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx158
start..stop
S start..stop
SbPrx11 559 0 1..329 1..330
SbPrx09 491 8e-177 12..329 14..331
SiPrx156 487 4e-175 27..329 29..330
ZmPrx126 486 7e-175 25..329 13..317
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 36487504..36487731 228 N° 2 36487818..36488576 759  
join(36487504..36487731,36487818..36488576)


exon

Literature and cross-references SiPrx158 (Si036586m)
DNA ref. Phytozome 12:   scaffold_9 (36487504..36488576)
Protein sequence: SiPrx158 (Si036586m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (302)
PWM (Da):   %s   35325.07 (32630.6) Transmb domain:   %s   i7-29o
PI (pH):   %s   9.1 (8.82) Peptide Signal:   %s   cut: 28 range:28-329
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASAARMSAPALMVTLAVLALVAGGRAQLQYGFYKGKCNASDVEAVVQSLVKARFAREAAIVAYLLRLQFHECAVNGCDGSLLIDGPGTEKTAPPNLSVKGYDLIATIKAELEKKCPGVVSCSDIEILATRDAVALAGGPPYAVRTGRRDRRQSRAYDVKLPGADYTAAQAVAYYTRLGMNAYDTVVLLGAHTVGATHCSAIKNSRLYGYGGKPGATDPGMDPATASVYKRYVCPNVSSSDGNTVFLDDQWSAVKVDNHYYRNLQLRRGVLSVDQNLYNDGSTRWIVDQLASNAGLFQSQFARVLVKLSEVNVLTGTQGEIRKVCSKFN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCAGCAGCGCGCATGAGTGCGCCGGCGCTAATGGTGACCTTGGCCGTGCTGGCATTAGTCGCCGGCGGCCGTGCGCAGCTGCAGTACGGTTTCTACAAGGGCAAGTGCAACGCT
AGCGATGTGGAGGCGGTGGTGCAGAGCCTCGTCAAGGCCCGCTTCGCCCGCGAGGCCGCGATCGTCGCCTACCTCCTCCGTCTGCAATTCCACGAGTGCGCCGTCAAC
GTACGTTACCAC
CAACCATGTCTCCATGCACCGATTGTTACGGAGGGTTCGCCGTTGATTAACATGGCAAGAGATTATAATTGCAGGGGTGCGACGGCAGTCTGCTGATCGACGGACCCGGCACGGAGAAGA
CGGCGCCGCCGAATCTGAGCGTTAAGGGCTACGACCTCATCGCGACCATCAAGGCGGAGCTGGAAAAGAAGTGCCCCGGCGTGGTTTCGTGCTCCGACATCGAGATCCTCGCCACCAGGG
ACGCGGTCGCTCTTGCCGGCGGGCCGCCGTACGCGGTGCGCACGGGGCGCAGGGACCGCCGCCAGTCCCGGGCCTACGACGTCAAGCTCCCGGGGGCCGACTACACGGCGGCGCAGGCCG
TCGCGTACTACACCAGGCTGGGGATGAACGCGTACGACACGGTGGTGCTGCTGGGCGCACACACCGTTGGCGCCACGCACTGCAGCGCCATCAAGAACAGCCGGCTGTACGGGTACGGCG
GCAAGCCCGGCGCGACGGACCCCGGCATGGACCCCGCCACCGCGTCAGTGTACAAGAGGTACGTGTGCCCGAACGTCTCGTCATCGGACGGGAACACCGTGTTCCTTGACGACCAGTGGA
GCGCGGTCAAGGTGGACAACCACTACTACAGAAACCTGCAGCTCCGCCGCGGCGTCCTCTCCGTTGACCAGAATCTCTACAACGACGGGTCCACACGTTGGATCGTCGACCAGCTCGCCA
GCAATGCTGGGCTCTTCCAGTCGCAGTTCGCCAGGGTTCTGGTAAAGCTCAGCGAGGTCAACGTGCTCACCGGCACTCAGGGAGAGATCCGCAAGGTCTGCAGCAAGTTTAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCTCAGCAGCGCGCATGAGTGCGCCGGCGCTAATGGTGACCTTGGCCGTGCTGGCATTAGTCGCCGGCGGCCGTGCGCAGCTGCAGTACGGTTTCTACAAGGGCAAGTGCAACGCT
AGCGATGTGGAGGCGGTGGTGCAGAGCCTCGTCAAGGCCCGCTTCGCCCGCGAGGCCGCGATCGTCGCCTACCTCCTCCGTCTGCAATTCCACGAGTGCGCCGTCAAC
GGGTGCGACGGC
AGTCTGCTGATCGACGGACCCGGCACGGAGAAGACGGCGCCGCCGAATCTGAGCGTTAAGGGCTACGACCTCATCGCGACCATCAAGGCGGAGCTGGAAAAGAAGTGCCCCGGCGTGGTT
TCGTGCTCCGACATCGAGATCCTCGCCACCAGGGACGCGGTCGCTCTTGCCGGCGGGCCGCCGTACGCGGTGCGCACGGGGCGCAGGGACCGCCGCCAGTCCCGGGCCTACGACGTCAAG
CTCCCGGGGGCCGACTACACGGCGGCGCAGGCCGTCGCGTACTACACCAGGCTGGGGATGAACGCGTACGACACGGTGGTGCTGCTGGGCGCACACACCGTTGGCGCCACGCACTGCAGC
GCCATCAAGAACAGCCGGCTGTACGGGTACGGCGGCAAGCCCGGCGCGACGGACCCCGGCATGGACCCCGCCACCGCGTCAGTGTACAAGAGGTACGTGTGCCCGAACGTCTCGTCATCG
GACGGGAACACCGTGTTCCTTGACGACCAGTGGAGCGCGGTCAAGGTGGACAACCACTACTACAGAAACCTGCAGCTCCGCCGCGGCGTCCTCTCCGTTGACCAGAATCTCTACAACGAC
GGGTCCACACGTTGGATCGTCGACCAGCTCGCCAGCAATGCTGGGCTCTTCCAGTCGCAGTTCGCCAGGGTTCTGGTAAAGCTCAGCGAGGTCAACGTGCTCACCGGCACTCAGGGAGAG
ATCCGCAAGGTCTGCAGCAAGTTTAAC

Retrieve as FASTA