Entry information : SiPrx159 (Si036602m)
Entry ID 9502
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx159 (Si036602m)
Name (synonym) SiPrx159 (Si036602m)
Class Class III peroxidase    [Orthogroup: Prx023]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx159
start..stop
S start..stop
SbPrx06 557 0 1..326 1..326
ZmPrx86 530 0 7..326 8..331
ZmPrx11 522 0 1..326 1..328
OsPrx126 515 0 1..326 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 29685888..29686106 219 N° 2 29686224..29686406 183 N° 3 29686525..29686690 166 N° 4 29686876..29687288 413
join(29685888..29686106,29686224..29686406,29686525..29686690,29686876..29687288 )


exon

Literature and cross-references SiPrx159 (Si036602m)
DNA ref. Phytozome 12:   scaffold_9 (29685888..29687288)
Protein sequence: SiPrx159 (Si036602m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (301)
PWM (Da):   %s   35380.22 (32417.7)  
PI (pH):   %s   4.53 (4.38) Peptide Signal:   %s   cut: 27 range:27-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MEHAYSRLLVVFSVLSLCLGNQGVRCQLTSDFYDETCPHLYTIVQQHVFTAMRAEMRMGASLLRLHFHDCFVNGCDGSILLDRSDGEKFAQPNLNSVRGYEVIDAIKADLESLCPEVVSCADIVALAAGYGVLFSGGPYWDVLLGRKDGLVANQSGADNGLPAPFEPIDSIIQKFNAVGLNTTDVVVLSGAHTIGRSRCVLFSNRLSNFSATNSVDPTLDASLADSLQSLCAGGDGNQTTALDVSSGDVFDNYYYQNLLANKGLLSSDQGLFSSPQGTANTKDLVRTYSHDEDQFFCDFGWSMIKMGNIPLTGSEGEIRKNCRVVNS*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAACACGCTTACTCCCGGTTGCTGGTTGTATTTTCGGTTCTTTCACTGTGCCTCGGTAACCAGGGTGTGAGATGTCAGCTCACCTCTGATTTCTACGACGAAACATGTCCTCATTTG
TACACTATCGTGCAGCAGCATGTGTTCACTGCCATGAGAGCTGAGATGAGGATGGGCGCCTCCCTCCTCAGGCTCCATTTCCATGACTGCTTTGTCAAT
GTAACTGTCTTGACTGACTTC
TAATCTCTTAACCCTGAGTCTCTGATAATGTTCTGTAGATCGATGCAGCTCTATGTTGCTGAGTTACCGAAATGGTGTGAAATTTCATATATGCAGGGATGTGATGGTTCAATACTTTTG
GACCGCAGCGATGGCGAGAAGTTTGCACAACCCAACCTGAACTCAGTTAGAGGGTACGAGGTCATTGACGCCATAAAGGCTGATCTCGAGAGCCTCTGCCCTGAGGTGGTGTCTTGCGCT
GACATCGTAGCCCTTGCAGCAGGCTATGGAGTGCTCTTT
GTACGCTCCTAGTAGCCCTTCCAGTCAAGTTTGTTGGAACACTAAGTTTTGCTAGACAGAGTACTAACGGTGCAAGACGGC
TGTGACGTAGTGACGTGTACTGATTTTTGTTGTTCAGAGTGGAGGGCCATATTGGGATGTTCTTCTGGGAAGAAAAGACGGTCTGGTGGCCAATCAGTCTGGAGCTGACAACGGCTTGCC
TGCGCCATTTGAACCGATAGACTCCATTATTCAGAAGTTCAACGCCGTCGGCCTGAACACGACCGATGTCGTGGTCTTATCGG
GTAAATATCATGAATCAGTTACAGCTACTTCTACTTC
CACGTTCTCCTACAAGTTTCAGAGCTAGTCCTTACACGTTCGTAGCTCACTCAGAAGCAGTTATTAAGATTATTAATTATACATCAAGTTTCACGTGATCTGTTAAGATTCTACGGAACT
CACATGCTCTCAACCTGAAATTGGACAGGAGCCCACACGATCGGCCGATCCCGGTGCGTGCTGTTCAGCAATCGCCTGTCAAACTTCTCGGCGACGAATTCAGTAGATCCGACGCTGGAT
GCCAGCCTCGCCGACAGCCTTCAGAGCCTCTGTGCAGGCGGCGACGGCAACCAGACCACCGCTCTCGACGTCAGCTCCGGCGACGTGTTCGACAACTACTACTACCAGAACCTCCTGGCC
AATAAGGGCCTGCTGTCCTCCGACCAGGGCCTCTTTTCAAGCCCGCAAGGCACTGCCAACACAAAGGATCTCGTGCGGACCTACAGCCACGACGAGGATCAATTCTTCTGCGATTTCGGC
TGGTCCATGATCAAGATGGGGAACATCCCTCTCACGGGCTCGGAAGGGGAGATCCGCAAGAACTGCAGGGTTGTCAACTCA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGAACACGCTTACTCCCGGTTGCTGGTTGTATTTTCGGTTCTTTCACTGTGCCTCGGTAACCAGGGTGTGAGATGTCAGCTCACCTCTGATTTCTACGACGAAACATGTCCTCATTTG
TACACTATCGTGCAGCAGCATGTGTTCACTGCCATGAGAGCTGAGATGAGGATGGGCGCCTCCCTCCTCAGGCTCCATTTCCATGACTGCTTTGTCAAT
GGATGTGATGGTTCAATACTT
TTGGACCGCAGCGATGGCGAGAAGTTTGCACAACCCAACCTGAACTCAGTTAGAGGGTACGAGGTCATTGACGCCATAAAGGCTGATCTCGAGAGCCTCTGCCCTGAGGTGGTGTCTTGC
GCTGACATCGTAGCCCTTGCAGCAGGCTATGGAGTGCTCTTT
AGTGGAGGGCCATATTGGGATGTTCTTCTGGGAAGAAAAGACGGTCTGGTGGCCAATCAGTCTGGAGCTGACAACGGC
TTGCCTGCGCCATTTGAACCGATAGACTCCATTATTCAGAAGTTCAACGCCGTCGGCCTGAACACGACCGATGTCGTGGTCTTATCGG
GAGCCCACACGATCGGCCGATCCCGGTGCGTG
CTGTTCAGCAATCGCCTGTCAAACTTCTCGGCGACGAATTCAGTAGATCCGACGCTGGATGCCAGCCTCGCCGACAGCCTTCAGAGCCTCTGTGCAGGCGGCGACGGCAACCAGACCACC
GCTCTCGACGTCAGCTCCGGCGACGTGTTCGACAACTACTACTACCAGAACCTCCTGGCCAATAAGGGCCTGCTGTCCTCCGACCAGGGCCTCTTTTCAAGCCCGCAAGGCACTGCCAAC
ACAAAGGATCTCGTGCGGACCTACAGCCACGACGAGGATCAATTCTTCTGCGATTTCGGCTGGTCCATGATCAAGATGGGGAACATCCCTCTCACGGGCTCGGAAGGGGAGATCCGCAAG
AACTGCAGGGTTGTCAACTCA

Retrieve as FASTA