Entry information : SiPrx160 (Si036611m)
Entry ID 9504
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx160 (Si036611m)
Name (synonym) SiPrx160 (Si036611m)
Class Class III peroxidase    [Orthogroup: Prx097]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx160
start..stop
S start..stop
ZmPrx108_35A19 577 0 21..326 24..330
ZmPrx108 575 0 1..326 1..328
SbPrx03 573 0 1..326 1..334
ZmPrx141 530 0 21..326 26..332
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 4845906..4846121 216 N° 2 4845620..4845814 195 N° 3 4844941..4845507 567  
complement(join(4844941..4845507,4845620..4845814,4845906..4846121))


exon

Literature and cross-references SiPrx160 (Si036611m)
DNA ref. Phytozome 12:   scaffold_9 (4846121..4844941)
Protein sequence: SiPrx160 (Si036611m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   327 (306)
PWM (Da):   %s   34634.23 (32632.1)  
PI (pH):   %s   5.15 (4.98) Peptide Signal:   %s   cut: 21 range:21-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARPPLLVLAVAAAAVCGLAQPGAADLKVDYYASTCPNVEAIVRGVVQQKMQATIRSIGSTIRLFFHDCFVEGCDGSVLIESTPDNQAEKDASDNKSLAFEGFDTVRSAKAAVEAACPDTVSCADVLALATRDAIAMSGGPSFPIELGRLDGLSSNASSVPGQLPEPNQTMDQLLAVFKAHGLNMSDLVALSAAHSVGLAHCSKFSNRLYRYQPGQPTDPTLNPTYARFLESKCPDGGPDNLVLMDQASPAQLDNQYYRNLQDGGGLLGSDELLYTDNRTRAMVDALANSTTAFYKAFADAIVRLGRVGVKSGRRGNIRKQCDVFN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGACCGCCGTTGCTCGTCCTCGCGGTCGCCGCCGCCGCCGTCTGCGGCCTCGCGCAGCCTGGAGCGGCCGACCTGAAGGTGGACTACTACGCGAGCACCTGCCCGAACGTGGAG
GCCATCGTGCGCGGCGTGGTGCAGCAGAAGATGCAGGCCACCATCCGGAGCATCGGCTCCACCATCCGCCTCTTCTTCCACGACTGCTTCGTAGAG
GTTCAGATTAGTTCTGCATGTTCA
GTCGAAAAACGCAGAGCGCACCATGTAGTCCTATACGGGAAACTAAAAGTAGCGATGGATTTACCAGGGTTGCGACGGGTCGGTGCTGATCGAGTCGACGCCGGACAACCAGGCCGAGAA
GGACGCCTCCGACAACAAGTCCCTCGCGTTCGAAGGCTTCGACACGGTGCGGAGCGCCAAGGCCGCCGTCGAGGCCGCCTGCCCCGACACCGTCTCCTGCGCCGACGTGCTCGCCCTCGC
CACTCGAGACGCGATCGCCATG
GTACGTTCTATATCAGAGTCCATGCATTTGCAGCTTCCTTTTGCCTTTTGCCAAGCCATTATGTGCACGCCTGGCACGATACATAATTTGCGCATCTT
TCGTTTGTGTGCAGAGTGGCGGGCCCTCCTTCCCGATTGAGCTGGGCAGGCTGGACGGCCTGAGCTCCAACGCCAGCAGCGTACCAGGCCAGCTGCCCGAGCCGAACCAGACCATGGACC
AGCTGCTGGCGGTCTTCAAGGCGCACGGGCTCAACATGTCCGACCTCGTCGCGCTCTCAGCGGCGCACAGCGTGGGTCTGGCGCACTGCAGCAAGTTCTCGAACCGGCTGTACAGGTACC
AGCCGGGGCAGCCGACGGACCCGACGCTGAACCCCACGTACGCGAGGTTCCTGGAGAGCAAGTGCCCCGACGGCGGCCCGGACAACCTGGTGCTCATGGACCAGGCCTCGCCGGCGCAGC
TCGACAACCAGTACTACCGGAACCTGCAGGACGGCGGCGGGCTGCTGGGCTCCGACGAGCTGCTCTACACCGACAACCGGACGCGGGCCATGGTGGACGCGCTCGCCAACAGCACCACCG
CCTTCTACAAGGCCTTCGCCGACGCCATCGTCAGGCTCGGCCGCGTCGGGGTCAAGTCCGGCAGGCGGGGCAACATCCGCAAGCAGTGCGACGTCTTCAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTAGACCGCCGTTGCTCGTCCTCGCGGTCGCCGCCGCCGCCGTCTGCGGCCTCGCGCAGCCTGGAGCGGCCGACCTGAAGGTGGACTACTACGCGAGCACCTGCCCGAACGTGGAG
GCCATCGTGCGCGGCGTGGTGCAGCAGAAGATGCAGGCCACCATCCGGAGCATCGGCTCCACCATCCGCCTCTTCTTCCACGACTGCTTCGTAGAG
GGTTGCGACGGGTCGGTGCTGATC
GAGTCGACGCCGGACAACCAGGCCGAGAAGGACGCCTCCGACAACAAGTCCCTCGCGTTCGAAGGCTTCGACACGGTGCGGAGCGCCAAGGCCGCCGTCGAGGCCGCCTGCCCCGACACC
GTCTCCTGCGCCGACGTGCTCGCCCTCGCCACTCGAGACGCGATCGCCATG
AGTGGCGGGCCCTCCTTCCCGATTGAGCTGGGCAGGCTGGACGGCCTGAGCTCCAACGCCAGCAGCGTA
CCAGGCCAGCTGCCCGAGCCGAACCAGACCATGGACCAGCTGCTGGCGGTCTTCAAGGCGCACGGGCTCAACATGTCCGACCTCGTCGCGCTCTCAGCGGCGCACAGCGTGGGTCTGGCG
CACTGCAGCAAGTTCTCGAACCGGCTGTACAGGTACCAGCCGGGGCAGCCGACGGACCCGACGCTGAACCCCACGTACGCGAGGTTCCTGGAGAGCAAGTGCCCCGACGGCGGCCCGGAC
AACCTGGTGCTCATGGACCAGGCCTCGCCGGCGCAGCTCGACAACCAGTACTACCGGAACCTGCAGGACGGCGGCGGGCTGCTGGGCTCCGACGAGCTGCTCTACACCGACAACCGGACG
CGGGCCATGGTGGACGCGCTCGCCAACAGCACCACCGCCTTCTACAAGGCCTTCGCCGACGCCATCGTCAGGCTCGGCCGCGTCGGGGTCAAGTCCGGCAGGCGGGGCAACATCCGCAAG
CAGTGCGACGTCTTCAAC

Retrieve as FASTA