Entry information : SiPrx164 (Si036635m)
Entry ID 9507
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx164 (Si036635m)
Name (synonym) SiPrx164 (Si036635m)
Class Class III peroxidase    [Orthogroup: Prx014]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx164
start..stop
S start..stop
ZmPrx05 573 0 8..323 4..319
SbPrx12 565 0 1..323 1..325
OsPrx128 539 0 6..323 11..338
SofPrx07 511 0 3..289 4..294
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 40240575..40240793 219 N° 2 40240299..40240487 189 N° 3 40239002..40239562 561  
complement(join(40239002..40239562,40240299..40240487,40240575..40240793))


exon

Literature and cross-references SiPrx164 (Si036635m)
DNA ref. Phytozome 12:   scaffold_9 (40240793..40239002)
Protein sequence: SiPrx164 (Si036635m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   324
PWM (Da):   %s   33475.75 Transmb domain:   %s   i7-24o
PI (pH):   %s   7.7
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVQRMALYFQVAAVVVLLTATGLRAQLRVGFYDNSCPAAEIIVQQEVSKAVGANPGLAAGLLRLHFHDCFVKGCDASVLIDSTPGNTAEKDAGPNTSLRGFEVVDRIKARVEQACSGVVSCADILAFAARDSVALAGGNAYQVPAGRRDGAVSRASDTGGNLPPPTANVAQLTQIFGTKGLTQKDMVVLSGAHTIGSSHCSSFSSRLSRSGTTAGQDPTMDPAYVAQLARQCPQGGDPLVPMDYVSPNAFDEGFYKGVMANRGLLSSDQALLSDKNTAVQVVTYANDPATFQSDFAAAMVKMGSVGVLTGSSGKIRGNCRVA*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGTGCAGAGGATGGCACTGTACTTTCAGGTGGCGGCGGTGGTGGTGCTTCTGACGGCGACGGGGCTCCGCGCGCAGCTGCGGGTGGGGTTCTACGACAACTCCTGCCCGGCGGCG
GAGATCATCGTGCAGCAGGAGGTGAGCAAGGCGGTGGGCGCCAACCCGGGCCTCGCCGCCGGCCTGCTCCGGCTCCACTTCCACGACTGCTTCGTCAAG
GTCAGTAGTGTCCATCTTCCA
TCTGCAGAAAGCACTACAGCTGTGGATGCTTTGCTGAACTAGCGGTTTGCGGACTTGCGATTGCAGGGGTGCGACGCGTCGGTGCTGATCGACTCGACCCCCGGCAACACGGCGGAGAAG
GACGCCGGGCCCAACACCAGCCTGCGGGGCTTCGAGGTCGTCGACCGCATCAAGGCGCGCGTCGAGCAGGCCTGCTCCGGCGTCGTCTCCTGCGCGGACATACTCGCCTTCGCCGCCAGG
GACAGCGTTGCGCTG
GTGAGTTTGAACCTAGATTCACCCGTTAGTTTAAGCTCGCACTTTGGGGGAGTACACTGCAAAGCTGCATTTGTCAATACTAAACTAAACTTGGCGCTTTGGTAT
TGTCACTGTCAGTGGACGGTGCTGGTCTCCCCCTGCTTCAGTGATGGCGAGACTTTTAAAACCAGACATGCCGATATGAATTTGGAATCTAGCACGCAGGATTAGACAGTATAAAGAAAA
GTTAATCTGACCCCTGTCCCCGACTTTTCTGAGGCACATTGCGCGCCCCCACCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATGATGCCGCCGCGGCGCGCAGGGCGCA
GGCAGAGGCAGCTGCCCGCACGCCAGAAAGAACTCGATGCCTGTATGGGTCCAACCGCACCACGCTTAGCACGCACGCCATTGTCGCGTCCCTTCCTTAGGAATCATCCGTGGTACTCAT
GCTTGCTTTGCTTGTGGGTCCGTGCGTGCAGGCCGGCGGGAACGCGTACCAGGTGCCGGCGGGCCGCCGGGACGGCGCCGTGTCGCGCGCGTCGGACACGGGCGGCAACCTGCCGCCGCC
GACGGCGAACGTGGCGCAGCTGACGCAGATCTTCGGCACCAAGGGCCTAACGCAGAAGGACATGGTGGTGCTCTCGGGCGCGCACACCATCGGCTCCTCGCACTGCAGCTCCTTCAGCAG
CCGGCTGTCGCGGTCGGGCACCACGGCGGGGCAGGACCCCACCATGGACCCGGCCTACGTGGCGCAGCTGGCGAGGCAGTGCCCGCAGGGAGGGGACCCGCTGGTGCCTATGGACTACGT
CTCCCCCAACGCCTTCGACGAGGGGTTCTACAAGGGCGTCATGGCCAACCGCGGCCTGCTGTCCTCGGACCAGGCGCTGCTCAGCGACAAGAACACGGCCGTGCAGGTCGTCACCTACGC
CAACGACCCGGCCACGTTCCAGAGCGACTTCGCCGCCGCCATGGTGAAGATGGGATCCGTCGGCGTGCTCACCGGAAGCAGCGGCAAGATCAGGGGCAACTGCAGGGTCGCC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGTGCAGAGGATGGCACTGTACTTTCAGGTGGCGGCGGTGGTGGTGCTTCTGACGGCGACGGGGCTCCGCGCGCAGCTGCGGGTGGGGTTCTACGACAACTCCTGCCCGGCGGCG
GAGATCATCGTGCAGCAGGAGGTGAGCAAGGCGGTGGGCGCCAACCCGGGCCTCGCCGCCGGCCTGCTCCGGCTCCACTTCCACGACTGCTTCGTCAAG
GGGTGCGACGCGTCGGTGCTG
ATCGACTCGACCCCCGGCAACACGGCGGAGAAGGACGCCGGGCCCAACACCAGCCTGCGGGGCTTCGAGGTCGTCGACCGCATCAAGGCGCGCGTCGAGCAGGCCTGCTCCGGCGTCGTC
TCCTGCGCGGACATACTCGCCTTCGCCGCCAGGGACAGCGTTGCGCTG
GCCGGCGGGAACGCGTACCAGGTGCCGGCGGGCCGCCGGGACGGCGCCGTGTCGCGCGCGTCGGACACGGGC
GGCAACCTGCCGCCGCCGACGGCGAACGTGGCGCAGCTGACGCAGATCTTCGGCACCAAGGGCCTAACGCAGAAGGACATGGTGGTGCTCTCGGGCGCGCACACCATCGGCTCCTCGCAC
TGCAGCTCCTTCAGCAGCCGGCTGTCGCGGTCGGGCACCACGGCGGGGCAGGACCCCACCATGGACCCGGCCTACGTGGCGCAGCTGGCGAGGCAGTGCCCGCAGGGAGGGGACCCGCTG
GTGCCTATGGACTACGTCTCCCCCAACGCCTTCGACGAGGGGTTCTACAAGGGCGTCATGGCCAACCGCGGCCTGCTGTCCTCGGACCAGGCGCTGCTCAGCGACAAGAACACGGCCGTG
CAGGTCGTCACCTACGCCAACGACCCGGCCACGTTCCAGAGCGACTTCGCCGCCGCCATGGTGAAGATGGGATCCGTCGGCGTGCTCACCGGAAGCAGCGGCAAGATCAGGGGCAACTGC
AGGGTCGCC

Retrieve as FASTA