Entry information : SiPrx165 (Si036729m)
Entry ID 9508
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx165 (Si036729m)
Name (synonym) SiPrx165 (Si036729m)
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx165
start..stop
S start..stop
SofPrx11 563 0 1..313 7..319
ZmPrx120 539 0 15..313 22..321
SbPrx18 538 0 5..313 19..327
OsPrx40 512 0 15..312 21..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 46955192..46955371 180 N° 2 46954899..46955093 195 N° 3 46954236..46954799 564  
complement(join(46954236..46954799,46954899..46955093,46955192..46955371))


exon

Literature and cross-references SiPrx165 (Si036729m)
DNA ref. Phytozome 11:   scaffold_9 (46955371..46954236)
Protein sequence: SiPrx165 (Si036729m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   314
PWM (Da):   %s   33209.69  
PI (pH):   %s   7.41
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MALALLATPSRGQLLDTHFYDKACPAALPTIKRVVEEAVAAEPRMGASLLRLHFHDCFVNGCDGSILLDDTPFFTGEKRASPNVNSVRGFDVIDRIKAAVNAACRGNVVSCADIVAVAARDSVVALGGPSYDVPLGRRDARTASQAAANNSIPAPTFNLDRLASSFASHGLSLQDLVVLSGGHTLGFSRCTNFRDRLYNETDTLDGALAASLQAVCPRATGSGDDNLAPLDPTPARFDGGYYASLLRGRGVLHSDQQLFAAGGVADALVRFYAANGDAFRRDFADAMVRMASLSPLTGTRGEIRYNCRKVNYS

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTGGCTCTCTTGGCAACGCCCAGCCGCGGGCAGCTCCTGGACACGCACTTCTACGACAAGGCGTGCCCCGCGGCGCTCCCCACCATCAAGCGGGTGGTGGAGGAGGCCGTGGCC
GCGGAGCCGCGCATGGGCGCCTCGCTCCTGCGCCTGCACTTCCACGACTGCTTCGTCAAC
GTACGCCTACGCAGATGCATTATTTATTATTAGTCACGCCTCGTGCATGCGTAGTGTCCT
GAACTCCTGATCTTTGTGCGTGCTCCATTGATTCCCAGGGGTGCGACGGGTCCATCCTGCTGGACGACACGCCCTTCTTCACCGGCGAGAAGAGAGCCTCGCCGAACGTCAACTCCGTCC
GCGGCTTCGACGTGATCGACCGCATCAAGGCCGCCGTCAACGCCGCCTGCAGGGGCAACGTCGTCTCCTGCGCCGACATCGTCGCCGTCGCGGCGCGCGACTCCGTCGTCGCG
GTCCGTT
CTAGTTCGCGCCTCCATTGTTGCTGCACAGAAACCTTTACGTCATTCATGCACCAAATATATATATAATCCGTCGTTGTCGTCTGCGTGCAGCTGGGAGGGCCGTCGTACGACGTGCCAC
TGGGCCGCCGGGACGCGCGCACGGCGAGCCAGGCGGCGGCGAACAACAGCATCCCGGCGCCGACCTTCAACCTCGACCGCCTCGCTTCCAGCTTCGCCTCGCACGGCCTCTCCCTCCAGG
ACCTCGTCGTGCTCTCCGGCGGCCACACGCTGGGCTTCTCCCGCTGCACCAACTTCCGGGACCGCCTCTACAACGAGACCGACACCCTGGACGGCGCCCTCGCGGCGTCGCTCCAGGCGG
TGTGCCCGCGCGCCACCGGCAGCGGCGACGACAACCTCGCACCGCTCGACCCGACGCCCGCGCGGTTCGACGGCGGGTACTACGCGTCGCTGCTGCGGGGCAGGGGCGTCCTGCACTCGG
ACCAGCAGCTGTTCGCTGCCGGCGGCGTCGCCGACGCGCTCGTGAGGTTCTACGCCGCGAACGGCGACGCGTTCAGGAGGGACTTCGCTGATGCCATGGTGAGGATGGCCAGCCTCAGCC
CGCTCACCGGGACCCGCGGCGAGATCCGATACAACTGCAGGAAGGTGAACTACTCT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTTGGCTCTCTTGGCAACGCCCAGCCGCGGGCAGCTCCTGGACACGCACTTCTACGACAAGGCGTGCCCCGCGGCGCTCCCCACCATCAAGCGGGTGGTGGAGGAGGCCGTGGCC
GCGGAGCCGCGCATGGGCGCCTCGCTCCTGCGCCTGCACTTCCACGACTGCTTCGTCAAC
GGGTGCGACGGGTCCATCCTGCTGGACGACACGCCCTTCTTCACCGGCGAGAAGAGAGCC
TCGCCGAACGTCAACTCCGTCCGCGGCTTCGACGTGATCGACCGCATCAAGGCCGCCGTCAACGCCGCCTGCAGGGGCAACGTCGTCTCCTGCGCCGACATCGTCGCCGTCGCGGCGCGC
GACTCCGTCGTCGCG
CTGGGAGGGCCGTCGTACGACGTGCCACTGGGCCGCCGGGACGCGCGCACGGCGAGCCAGGCGGCGGCGAACAACAGCATCCCGGCGCCGACCTTCAACCTCGAC
CGCCTCGCTTCCAGCTTCGCCTCGCACGGCCTCTCCCTCCAGGACCTCGTCGTGCTCTCCGGCGGCCACACGCTGGGCTTCTCCCGCTGCACCAACTTCCGGGACCGCCTCTACAACGAG
ACCGACACCCTGGACGGCGCCCTCGCGGCGTCGCTCCAGGCGGTGTGCCCGCGCGCCACCGGCAGCGGCGACGACAACCTCGCACCGCTCGACCCGACGCCCGCGCGGTTCGACGGCGGG
TACTACGCGTCGCTGCTGCGGGGCAGGGGCGTCCTGCACTCGGACCAGCAGCTGTTCGCTGCCGGCGGCGTCGCCGACGCGCTCGTGAGGTTCTACGCCGCGAACGGCGACGCGTTCAGG
AGGGACTTCGCTGATGCCATGGTGAGGATGGCCAGCCTCAGCCCGCTCACCGGGACCCGCGGCGAGATCCGATACAACTGCAGGAAGGTGAACTACTCT

Retrieve as FASTA