Entry information : SiPrx19 (Si002248m)
Entry ID 9518
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx19 (Si002248m)
Name (synonym) SiPrx19 (Si002248m)
Class Class III peroxidase    [Orthogroup: Prx308]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx19
start..stop
S start..stop
SbPrx64 563 0 3..322 4..323
SiPrx170 465 2e-166 1..322 1..322
BdiPrx41 463 8e-166 2..322 3..323
SiPrx155 462 2e-165 6..322 4..320
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 17110198..17110404 207 N° 2 17109343..17110101 759  
complement(join(17109343..17110101,17110198..17110404))


exon

Literature and cross-references SiPrx19 (Si002248m)
DNA ref. Phytozome 12:   scaffold_5 (17110404..17109343)
Protein sequence: SiPrx19 (Si002248m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   323 (299)
PWM (Da):   %s   33855.49 (31494.3) Transmb domain:   %s   i7-29o
PI (pH):   %s   9.35 (9.78) Peptide Signal:   %s   cut: 24 range:24-322
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAASIKLCLLVSCALVLATACDGLQVGYYRKTCPRAEALVRAEVKKAVRANTGVGAGLIRMLFHDCFVEGCDASVLLDPTAANPQPEKLGAPNNPSLRGYEVIDAAKAAVEKACPGTVSCADIVAFAGRDASYLLSHAKVSFHMPAGRLDGRKSLASETLTFLPGPSSNLSSLVSAFAAKGLSVEDVVVLSGAHSIGRSHCSSFVQARLSSPSDIAAPLATQLRKQCPASPTAANDPTVTQDVVSPDALDNQYYKNVLARKVLFTSDAALLSAPNTARMVRANARFPGSWEKKFAKAMVKMAAIGVKTGRDGEIRRNCRLVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCCAGCATTAAGCTCTGCTTACTAGTCTCGTGCGCTCTGGTTCTGGCCACGGCGTGCGATGGCCTGCAGGTGGGCTACTACAGGAAGACGTGCCCCAGGGCCGAGGCCCTCGTG
AGGGCCGAGGTGAAGAAGGCCGTTCGCGCCAACACCGGCGTCGGCGCTGGCCTCATCCGCATGCTCTTCCACGACTGCTTCGTCGAG
GTACGGTACAGTCATTCTGATGTGGCATGCATG
CATCCGACGAGAAATGGCACGTGTGTCGTGTGACTGACGAATGCAAGTGTGCGTGTGCTGCAGGGCTGCGACGCGTCCGTGCTCCTCGACCCGACGGCGGCGAACCCGCAGCCGGAGAAG
CTGGGGGCGCCCAACAACCCCAGCCTGCGTGGCTACGAGGTGATCGACGCGGCCAAGGCCGCCGTCGAGAAGGCCTGCCCCGGCACGGTCTCCTGCGCCGACATCGTCGCCTTCGCCGGG
CGCGACGCGTCCTATCTCCTCAGCCACGCTAAGGTCAGCTTCCACATGCCGGCGGGGCGGCTGGACGGGCGCAAGTCCCTCGCCAGCGAGACCCTCACGTTCCTGCCCGGCCCCTCCTCC
AACCTCTCCAGCCTCGTCTCCGCCTTCGCCGCCAAGGGGCTCAGCGTCGAGGACGTGGTGGTGCTCTCCGGCGCGCACTCCATTGGCCGGTCCCACTGCTCGTCCTTCGTCCAGGCACGC
CTGAGCTCGCCGTCCGACATCGCCGCTCCGCTGGCGACGCAGCTGAGGAAGCAGTGCCCGGCCAGCCCGACCGCTGCCAACGATCCGACGGTGACCCAGGACGTGGTCTCCCCGGACGCG
CTGGACAACCAATACTACAAGAACGTGCTGGCGCGCAAGGTGCTGTTCACGTCGGACGCCGCGCTGCTGTCGGCGCCCAACACCGCGAGGATGGTGCGCGCCAACGCCAGGTTCCCGGGT
TCGTGGGAGAAGAAGTTCGCCAAGGCGATGGTGAAGATGGCCGCCATCGGCGTGAAGACCGGCCGCGACGGCGAGATCAGGAGGAACTGCAGGCTCGTCAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCTGCCAGCATTAAGCTCTGCTTACTAGTCTCGTGCGCTCTGGTTCTGGCCACGGCGTGCGATGGCCTGCAGGTGGGCTACTACAGGAAGACGTGCCCCAGGGCCGAGGCCCTCGTG
AGGGCCGAGGTGAAGAAGGCCGTTCGCGCCAACACCGGCGTCGGCGCTGGCCTCATCCGCATGCTCTTCCACGACTGCTTCGTCGAG
GGCTGCGACGCGTCCGTGCTCCTCGACCCGACG
GCGGCGAACCCGCAGCCGGAGAAGCTGGGGGCGCCCAACAACCCCAGCCTGCGTGGCTACGAGGTGATCGACGCGGCCAAGGCCGCCGTCGAGAAGGCCTGCCCCGGCACGGTCTCCTGC
GCCGACATCGTCGCCTTCGCCGGGCGCGACGCGTCCTATCTCCTCAGCCACGCTAAGGTCAGCTTCCACATGCCGGCGGGGCGGCTGGACGGGCGCAAGTCCCTCGCCAGCGAGACCCTC
ACGTTCCTGCCCGGCCCCTCCTCCAACCTCTCCAGCCTCGTCTCCGCCTTCGCCGCCAAGGGGCTCAGCGTCGAGGACGTGGTGGTGCTCTCCGGCGCGCACTCCATTGGCCGGTCCCAC
TGCTCGTCCTTCGTCCAGGCACGCCTGAGCTCGCCGTCCGACATCGCCGCTCCGCTGGCGACGCAGCTGAGGAAGCAGTGCCCGGCCAGCCCGACCGCTGCCAACGATCCGACGGTGACC
CAGGACGTGGTCTCCCCGGACGCGCTGGACAACCAATACTACAAGAACGTGCTGGCGCGCAAGGTGCTGTTCACGTCGGACGCCGCGCTGCTGTCGGCGCCCAACACCGCGAGGATGGTG
CGCGCCAACGCCAGGTTCCCGGGTTCGTGGGAGAAGAAGTTCGCCAAGGCGATGGTGAAGATGGCCGCCATCGGCGTGAAGACCGGCCGCGACGGCGAGATCAGGAGGAACTGCAGGCTC
GTCAAC

Retrieve as FASTA