Entry information : SiPrx22 (Si003773m)
Entry ID 9520
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx22 (Si003773m)
Name (synonym) SiPrx22 (Si003773m)
Class Class III peroxidase    [Orthogroup: Prx022]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx22
start..stop
S start..stop
ZmPrx100 554 0 3..367 5..381
SbPrx78 551 0 3..367 5..391
OsPrx18 547 0 1..365 1..366
BdiPrx93 533 0 8..363 8..358
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 35021811..35022134 324 N° 2 35022253..35022607 355 N° 3 35022699..35023120 422  
join(35021811..35022134,35022253..35022607,35022699..35023120)


exon

Literature and cross-references SiPrx22 (Si003773m)
DNA ref. Phytozome 12:   scaffold_5 (35021811..35023120)
Protein sequence: SiPrx22 (Si003773m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   368 (347)
PWM (Da):   %s   39439.39 (37305.4)  
PI (pH):   %s   4.91 (5.00) Peptide Signal:   %s   cut: 21 range:21-367
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSGPLAWGALCFLAVSTVLCTVDLRSDATRSAAVLSLDDYEEDSDDGSPSFSFTFPETRPRGLVFGFYDETCPDAEEIVSSTVRGLYHTDPNVAAALVRLFFHDCFIHGCDASVLLDRVGGRKSERDAAPNQSLRGFGAVDAIKRRVEAACPGTVSCADILALAARDSLVLVGGPTYPVLTGRRDSAQSSYYDVGGNIPGPNATYAMTLDAFARRGFTERETVALLGAHSIGKVRCRFFTDRIYNFAGTGVPDDSIDPDMVGEMRAVCGGDGAAPMEMGYYRQGREVGFGAHYYAKLLEGRGILRADQQLTAGSTVRWVRVYASGARGEEVFREDFAHAMVKLSALAPLTGLDGQVRISCSKPVEDN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCGGACCTCTGGCGTGGGGAGCTCTCTGCTTCCTTGCCGTCTCGACCGTCCTGTGCACCGTCGATCTCCGTTCCGATGCCACCAGGTCCGCCGCCGTGCTCTCCCTCGACGACTAC
GAGGAGGATAGCGACGACGGCTCACCCTCCTTCTCCTTCACCTTCCCGGAGACGCGGCCGCGCGGGCTGGTGTTCGGGTTTTACGACGAGACGTGCCCGGACGCCGAGGAGATCGTGTCG
TCCACGGTGCGGGGGCTCTACCACACGGACCCCAACGTCGCTGCCGCTCTCGTCCGCCTCTTCTTCCACGACTGCTTCATCCAC
GTACGTACAGACACAAACCCCGTGCCCGGCCTCCTC
ATGTCGCCGTATTTTAGTTGCCTGCGACGCTCACGCGCGCACATGCCGAGATGCCGTCCTCTCCTGGATGACGCGCGTGCAGGGCTGCGACGCCTCGGTGCTCCTGGACCGCGTCGGCGG
CCGCAAGTCGGAGCGGGACGCCGCCCCGAACCAGTCGCTGCGAGGCTTCGGCGCCGTCGATGCCATCAAGCGGAGGGTGGAGGCGGCGTGCCCCGGGACCGTCTCCTGCGCGGACATCCT
GGCCCTCGCCGCGCGGGACAGCCTCGTCCTGGTGGGCGGGCCTACCTACCCGGTGCTCACCGGCCGCCGCGACAGCGCCCAGAGCTCCTACTACGACGTGGGCGGAAACATCCCGGGGCC
GAACGCCACCTACGCCATGACGCTCGACGCGTTCGCGCGCCGCGGCTTCACCGAGCGCGAGACCGTCGCGCTCTTAG
GTCCGTCTGCGCGCGCCCTCTGTCTGCCGATTTGAGGCCTCCG
AAGTAGCCTGACGCCTTTTCACGCTTCTTGGCGCGCGCGCTCCCGCAGGAGCGCACAGCATCGGGAAGGTGCGGTGCAGGTTCTTCACGGACAGGATCTATAACTTCGCCGGGACGGGCG
TGCCGGACGACTCCATCGACCCGGACATGGTGGGCGAGATGCGCGCGGTGTGCGGCGGCGACGGCGCGGCGCCGATGGAGATGGGGTACTACAGGCAGGGCCGGGAGGTGGGGTTCGGCG
CGCACTACTACGCGAAGCTGCTGGAGGGGCGGGGCATCCTGCGCGCGGACCAGCAGCTCACGGCAGGGAGCACCGTGCGGTGGGTGCGCGTGTACGCGTCCGGGGCGCGCGGCGAGGAGG
TGTTCCGCGAGGACTTCGCGCACGCCATGGTTAAGCTGTCGGCGCTCGCGCCGCTCACCGGGTTGGACGGACAGGTGCGGATCAGCTGCTCCAAGCCCGTCGAGGACAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGTCCGGACCTCTGGCGTGGGGAGCTCTCTGCTTCCTTGCCGTCTCGACCGTCCTGTGCACCGTCGATCTCCGTTCCGATGCCACCAGGTCCGCCGCCGTGCTCTCCCTCGACGACTAC
GAGGAGGATAGCGACGACGGCTCACCCTCCTTCTCCTTCACCTTCCCGGAGACGCGGCCGCGCGGGCTGGTGTTCGGGTTTTACGACGAGACGTGCCCGGACGCCGAGGAGATCGTGTCG
TCCACGGTGCGGGGGCTCTACCACACGGACCCCAACGTCGCTGCCGCTCTCGTCCGCCTCTTCTTCCACGACTGCTTCATCCAC
GGCTGCGACGCCTCGGTGCTCCTGGACCGCGTCGGC
GGCCGCAAGTCGGAGCGGGACGCCGCCCCGAACCAGTCGCTGCGAGGCTTCGGCGCCGTCGATGCCATCAAGCGGAGGGTGGAGGCGGCGTGCCCCGGGACCGTCTCCTGCGCGGACATC
CTGGCCCTCGCCGCGCGGGACAGCCTCGTCCTGGTGGGCGGGCCTACCTACCCGGTGCTCACCGGCCGCCGCGACAGCGCCCAGAGCTCCTACTACGACGTGGGCGGAAACATCCCGGGG
CCGAACGCCACCTACGCCATGACGCTCGACGCGTTCGCGCGCCGCGGCTTCACCGAGCGCGAGACCGTCGCGCTCTTAG
GAGCGCACAGCATCGGGAAGGTGCGGTGCAGGTTCTTCACG
GACAGGATCTATAACTTCGCCGGGACGGGCGTGCCGGACGACTCCATCGACCCGGACATGGTGGGCGAGATGCGCGCGGTGTGCGGCGGCGACGGCGCGGCGCCGATGGAGATGGGGTAC
TACAGGCAGGGCCGGGAGGTGGGGTTCGGCGCGCACTACTACGCGAAGCTGCTGGAGGGGCGGGGCATCCTGCGCGCGGACCAGCAGCTCACGGCAGGGAGCACCGTGCGGTGGGTGCGC
GTGTACGCGTCCGGGGCGCGCGGCGAGGAGGTGTTCCGCGAGGACTTCGCGCACGCCATGGTTAAGCTGTCGGCGCTCGCGCCGCTCACCGGGTTGGACGGACAGGTGCGGATCAGCTGC
TCCAAGCCCGTCGAGGACAAC

Retrieve as FASTA