Entry information : SiPrx29 (Si006871m)
Entry ID 9527
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-12-12 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2013-12-22 (Christophe Dunand)
Peroxidase information: SiPrx29 (Si006871m)
Name (synonym) SiPrx29 (Si006871m)
Class Class III peroxidase    [Orthogroup: Prx009]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx29
start..stop
S start..stop
SbPrx139 572 0 19..330 21..331
ZmPrx20 567 0 22..330 21..328
SofPrx01 560 0 19..330 21..331
OsPrx89 511 0 25..328 28..331
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 37834473..37834682 210 N° 2 37834156..37834347 192 N° 3 37833885..37834047 163 N° 4 37831386..37831813 428
complement(join(37831386..37831813,37833885..37834047,37834156..37834347,3783447 3..37834682))


exon

Literature and cross-references SiPrx29 (Si006871m)
DNA ref. Phytozome 12:   scaffold_4 (37831084..37834782)
Protein sequence: SiPrx29 (Si006871m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   330 (307)
PWM (Da):   %s   35459.02 (33296.8) Transmb domain:   %s   i5-22o
PI (pH):   %s   6.92 (6.51) Peptide Signal:   %s   cut: 24 range:24-330
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARMAVVAVVVVVAAVLAGGARAQLREGFYEHSCPQAEKIIKDYVMEHIPHVPSIAATLLRTHFHDCFVRGCDASVLLNATGGNEAERDAAPNQTLRGNGFIDRVKALVEKECPGVVSCADILALTARDSVVATGGPSWSVPTGRRDGTVSIKQEALDQIPAPTMNFTELLQSFQNKSLDLADLVWLSGAHTIGIAHCNSFTERLYNFTGRGGPGDADPSLDPLYAANLRRTKCKTPTDNTTIVEMDPGSFRTFDLSYYRGVLKRRGLFQSDAALITDAAAKADILTAVNSPPEFFSQVFARSMVKMGAIEVKTGSEGEIRKHCAIVNKH

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGAATGGCGGTGGTGGCGGTGGTGGTGGTGGTGGCAGCCGTGCTCGCCGGCGGCGCGCGGGCGCAGCTGAGGGAGGGGTTCTACGAGCACAGCTGCCCGCAGGCGGAGAAGATC
ATCAAGGACTACGTGATGGAGCACATCCCCCACGTGCCATCCATCGCCGCCACCCTCCTCCGCACGCACTTCCACGACTGCTTCGTCAGG
GTACGTGCCAGTGTCTAGTGTGTGCCGGCG
TGCTCTGTTCTTCTTCTTCTTCTTCCTGCCGGCGCGGCAGGGTACGTGGCGACGGACGCTGACGGCGGCCAATGCCGCCTCCTTCTTCCCTGCAGGGCTGCGACGCGTCGGTGCTGCTGA
ACGCGACGGGCGGGAACGAGGCGGAGAGGGACGCGGCGCCCAACCAGACGCTGCGCGGCAACGGCTTCATCGACCGCGTCAAGGCGCTCGTCGAGAAGGAGTGCCCCGGCGTCGTCTCCT
GCGCCGACATCCTCGCCCTCACCGCCCGCGACTCCGTCGTCGCCACC
GTGAGCACCCTTCCACCCGCTCCCCCCGCCGAAGCACCGCCGGCGACATTGCCGCGCCGACGCGCGGCAGCTA
GCTCGTCGTCGCTGACACGCTGAGAGTGAGTGCAGGGCGGGCCGTCCTGGAGCGTGCCGACGGGGCGGCGCGACGGCACGGTGTCCATCAAGCAGGAGGCGCTGGACCAGATCCCCGCGC
CCACCATGAACTTCACCGAGCTCCTCCAGTCGTTCCAGAACAAGAGCCTCGACCTCGCCGACCTCGTCTGGCTCTCAG
GTAACTCAAAACCTCTCTCCCTCCTCCCTCCTCCCTCCATTG
CCACCGCCATTCAGAGCTCATCAGTTACTACTTCACTGCTTTCACCTGACGACAACTTCAACAAATCTTTGGTAAAAAAAAACAAGCAAGCAAACAAGAAGATTCTTTCCACATGCCAAT
CAACCTAGCTAATTTTACACAAGGAAACAAATCAACAGTGACAGGGATGGTTATTAGTTACTAGTCCTCGGATTAGAATGGTTTTAGCTATCTGTTTAAACGTGGTGATCCTAACACGGC
ACCGACACAGAGTGATGTTACGTTTGCTGAGTGAATCATCCATCATTTGTTCGGAGAATACGTTTGCTCAGGCTGGCTGGCATAAGCTGTGAGATTGTACTTGGTTACTAGAAACAGTAC
TGGTAGTAGCTTTGGCAAATTGTTTATGTGTTGAGCCGGCAGTCAGCACACGTAGACACGCTCCTACCCACCCACTCTCTCTCAGCAGGACCAGTCCAAATGTCCCTGAGCTAGATTTTC
TTTTTCTTTTGCGAAGAATGTCCCTGAGCTAGATGGCTCCAAGGTAAACTTCTTTAGCTTGCCATGTGCATTGTACAGCAGAACAAAACAGTAGGAGCCTAGAACATTTTAGCAGCAGTG
AGTTCCACTCCATGTCATGGCCAGATTGGACAGACCTGAACATGCAGAGAGCCACAGACAGCGTGTCTTGATTACCGACTACTAGTATTAGTATTACATTACTGAATGGCACATTTATCA
TCAGCCAGATCTATGTACCCAAAAAAGACCAAAGTTCTGTCAGTCAAATCTGCACATAAAAGGCCAGAGTTCAGCATGATGCATGAGTGGCGTTTAGTGGCGTTGCATCATGGGCAAACC
AAATGTTAGGGAACTTACTTAACCTTGTCATTCTAGAATGAATCTAGCCAACAACAAAGGAGGCTTTTAAATTGGACAACTACCAGTCTGTTCATCCCCAGTCTTCGGATCAGTGCCGTG
TATAGCACATATGCACTTAGTCCTTGGGAAGAGACGCAGTATGGTAGTTAACATCTAAATGATGGTTTTGTCCTGTCTATGTAGCCAGAGTTTGGTAGCTGGAAAATGATTCCATATCAC
AATAGGGCATGGAACGCATACAGACAACTCCCCAGACTGAAAGCTCTGTGATACTAGCTTGCTAGTACTAAACTACAAGGAGAACAATGTCTAAAAAGTTAGCATTGGGGTAGTAACGGG
AAGAGATGTAACTAACCACCTTGGATGTAGTAGCATTGTTCAGAGCATGTTATCTTGCTAGAACAGGATCGATGACTTGAGTGAAAGTTGGAATCTGAGTACTTGTATGCACGTCATAAT
GTGATAAGGACGTCTTGGACTGCAGTCACTTGACTGGTTTGTTGTGTCACTGACGGGCATCGCATCTTTTATACGTGGACAACCTATCCTGATGCCGACATGCACGCTGCTGCTAACTGC
CATAAAATCAGTCTGTTCTGATTATTCTAACTTTTAAGGGCAACCACAATATTTTTTTGGCAAAGCAGGGAGGTTCTGAACGAGTACTACAATATTACTATCAGAGTAGTAAAAAATCAT
CTATATCCACCTCTGCCGCATACAAGTATAATAATTAAATATTCTATGGGCAGTCCATACCCTATCGTACTATGGGTGACTTTTTTTATTCTTTTCATATGGACTACTTGCACAATAATA
CTAGGAGGCCGAATTGAATAACTACTTCTCTACCACATTATGGACAGAAACTCCTGAACGAGAAGTAGGTTGATGCTGCATTGATACCATCATGTGCACACGACATTCCAAGCTAGGTGA
CAACTGCAGATAGAGTTATGAACCTATCGTATTTGTATCAGTTGCACCGAATGGTTTCGAAAACTCTAAGCTGAATAATTTCCTCCAAATTCTTAGCCATCCTGCAACAGTCACTGAATT
ACTACTGACTACTGTTATGTGCTAATCCGTGGTAATTTGCTAGCTGAACATTGTGGCTGCAACTCACCTGCTGTCTGCTGATGACCGATCACCTATGCTGTTCATGCAGGGGCTCACACC
ATCGGCATCGCGCACTGCAACTCCTTCACGGAGCGGCTCTACAACTTCACCGGGCGCGGTGGCCCCGGCGACGCGGACCCGTCGCTGGACCCGCTGTACGCGGCGAACCTCCGCCGGACC
AAGTGCAAGACGCCGACGGACAACACCACCATCGTCGAGATGGACCCGGGGAGCTTCCGGACCTTCGACCTCAGCTACTACCGTGGCGTGCTCAAGCGCCGGGGCCTGTTCCAGTCCGAC
GCCGCGCTCATCACCGACGCGGCGGCCAAGGCCGACATCCTCACCGCGGTGAACTCGCCGCCCGAGTTTTTCTCCCAGGTGTTCGCGCGCTCCATGGTGAAGATGGGCGCCATCGAGGTC
AAGACCGGGTCCGAGGGCGAGATCAGGAAGCACTGCGCCATCGTCAACAAGCACTAG

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGAATGGCGGTGGTGGCGGTGGTGGTGGTGGTGGCAGCCGTGCTCGCCGGCGGCGCGCGGGCGCAGCTGAGGGAGGGGTTCTACGAGCACAGCTGCCCGCAGGCGGAGAAGATC
ATCAAGGACTACGTGATGGAGCACATCCCCCACGTGCCATCCATCGCCGCCACCCTCCTCCGCACGCACTTCCACGACTGCTTCGTCAGG
GGCTGCGACGCGTCGGTGCTGCTGAACGCG
ACGGGCGGGAACGAGGCGGAGAGGGACGCGGCGCCCAACCAGACGCTGCGCGGCAACGGCTTCATCGACCGCGTCAAGGCGCTCGTCGAGAAGGAGTGCCCCGGCGTCGTCTCCTGCGCC
GACATCCTCGCCCTCACCGCCCGCGACTCCGTCGTCGCCACC
GGCGGGCCGTCCTGGAGCGTGCCGACGGGGCGGCGCGACGGCACGGTGTCCATCAAGCAGGAGGCGCTGGACCAGATC
CCCGCGCCCACCATGAACTTCACCGAGCTCCTCCAGTCGTTCCAGAACAAGAGCCTCGACCTCGCCGACCTCGTCTGGCTCTCAG
GGGCTCACACCATCGGCATCGCGCACTGCAACTCC
TTCACGGAGCGGCTCTACAACTTCACCGGGCGCGGTGGCCCCGGCGACGCGGACCCGTCGCTGGACCCGCTGTACGCGGCGAACCTCCGCCGGACCAAGTGCAAGACGCCGACGGACAAC
ACCACCATCGTCGAGATGGACCCGGGGAGCTTCCGGACCTTCGACCTCAGCTACTACCGTGGCGTGCTCAAGCGCCGGGGCCTGTTCCAGTCCGACGCCGCGCTCATCACCGACGCGGCG
GCCAAGGCCGACATCCTCACCGCGGTGAACTCGCCGCCCGAGTTTTTCTCCCAGGTGTTCGCGCGCTCCATGGTGAAGATGGGCGCCATCGAGGTCAAGACCGGGTCCGAGGGCGAGATC
AGGAAGCACTGCGCCATCGTCAACAAGCACTAG

Retrieve as FASTA