Entry information : SiPrx31 (Si006880m)
Entry ID 9529
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx31 (Si006880m)
Name (synonym) SiPrx31 (Si006880m)
Class Class III peroxidase    [Orthogroup: Prx053]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx31
start..stop
S start..stop
SbPrx129 597 0 1..328 5..332
SbPrx145 590 0 20..328 21..329
SiPrx30 590 0 1..328 1..329
SbPrx130 578 0 1..328 12..339
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 14889103..14889321 219 N° 2 14889442..14890206 765  
join(14889103..14889321,14889442..14890206)


exon

Literature and cross-references SiPrx31 (Si006880m)
DNA ref. Phytozome 11:   scaffold_4 (14889103..14890206)
Protein sequence: SiPrx31 (Si006880m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   329 (302)
PWM (Da):   %s   35573.22 (32920.8) Transmb domain:   %s   i7-26o
PI (pH):   %s   8.13 (7.97) Peptide Signal:   %s   cut: 27 range:27-328
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAVKSCVAMLIPLALLLLAGSSSVVAQLELDYYSKTCPNVEAIVREEMQKIISAAPSLAGPLLRLHFHDCFVRGCDASVLLNSTEGNLAERDAKPNKSLRGFGSVDRVKAKLEAACPNTVSCADVLTLMARDAVVLAKGPFWPVALGRRDGKVSSATEAADQLPPAFGDIPLLTKIFASKGLDLKDLVVLSGAHTLGTAHCPSFANRLYNFSSAYGADPSLDSEYADRLRIRCKRVDDKAMLSEMDPGSYKTFDTGYYRNVAKRRGLFQSDAALLTDASTREYVQRIATGKFDDVFFKDFSESMIKMGNVGVLTGVDGEIRKKCYIVN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGTCAAGTCTTGCGTAGCGATGCTGATACCTTTGGCACTCTTGCTTCTTGCGGGCAGCTCCTCAGTAGTGGCTCAGCTGGAACTCGACTACTACAGCAAGACATGCCCAAACGTC
GAGGCGATCGTCCGCGAGGAGATGCAAAAGATAATCTCCGCCGCACCAAGCCTCGCCGGTCCACTCCTAAGGCTTCATTTCCATGACTGCTTTGTCAGG
GTAAGTCGCCGTGTCACTGCA
AACTTAATCATGCGTGCTCTATGTGTAGTGAAATTTCAATTGATCAGGATGTAGAGCCGAGTACTGATGCAAACTCATGCATGCGCCTTAAAACTGCAGGGTTGTGACGCCTCGGTCTTG
CTCAACTCCACCGAGGGCAACCTGGCAGAGAGGGACGCCAAGCCCAACAAGAGCCTCAGGGGCTTCGGTTCAGTGGACAGGGTGAAGGCCAAGCTCGAGGCCGCCTGCCCCAACACCGTC
TCCTGCGCCGACGTCCTCACCCTCATGGCCCGCGACGCCGTCGTGCTTGCCAAGGGCCCATTCTGGCCGGTCGCGCTCGGGAGGCGAGACGGCAAGGTGTCCAGCGCCACGGAGGCGGCA
GACCAGCTGCCCCCTGCCTTCGGCGACATCCCGCTGCTCACCAAGATTTTCGCCTCCAAGGGCCTCGACCTCAAGGACCTCGTCGTCCTCTCGGGCGCGCACACCCTTGGCACGGCGCAC
TGCCCATCTTTCGCCAACCGGCTCTACAATTTCAGCAGTGCCTATGGCGCGGATCCATCCCTCGACAGCGAGTACGCCGACAGGCTCAGGATACGCTGCAAGAGAGTGGACGACAAGGCC
ATGCTGTCCGAGATGGACCCTGGCAGCTACAAGACCTTCGACACCGGCTACTACCGCAACGTCGCCAAGCGGAGGGGGCTCTTCCAGTCTGACGCCGCACTCCTCACCGATGCCAGCACC
AGGGAATACGTCCAGCGCATCGCCACCGGCAAGTTTGACGACGTGTTCTTCAAGGACTTCAGCGAGTCCATGATCAAGATGGGAAATGTCGGTGTGCTCACCGGAGTTGATGGGGAGATC
AGGAAGAAGTGCTACATCGTTAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAGTCAAGTCTTGCGTAGCGATGCTGATACCTTTGGCACTCTTGCTTCTTGCGGGCAGCTCCTCAGTAGTGGCTCAGCTGGAACTCGACTACTACAGCAAGACATGCCCAAACGTC
GAGGCGATCGTCCGCGAGGAGATGCAAAAGATAATCTCCGCCGCACCAAGCCTCGCCGGTCCACTCCTAAGGCTTCATTTCCATGACTGCTTTGTCAGG
GGTTGTGACGCCTCGGTCTTG
CTCAACTCCACCGAGGGCAACCTGGCAGAGAGGGACGCCAAGCCCAACAAGAGCCTCAGGGGCTTCGGTTCAGTGGACAGGGTGAAGGCCAAGCTCGAGGCCGCCTGCCCCAACACCGTC
TCCTGCGCCGACGTCCTCACCCTCATGGCCCGCGACGCCGTCGTGCTTGCCAAGGGCCCATTCTGGCCGGTCGCGCTCGGGAGGCGAGACGGCAAGGTGTCCAGCGCCACGGAGGCGGCA
GACCAGCTGCCCCCTGCCTTCGGCGACATCCCGCTGCTCACCAAGATTTTCGCCTCCAAGGGCCTCGACCTCAAGGACCTCGTCGTCCTCTCGGGCGCGCACACCCTTGGCACGGCGCAC
TGCCCATCTTTCGCCAACCGGCTCTACAATTTCAGCAGTGCCTATGGCGCGGATCCATCCCTCGACAGCGAGTACGCCGACAGGCTCAGGATACGCTGCAAGAGAGTGGACGACAAGGCC
ATGCTGTCCGAGATGGACCCTGGCAGCTACAAGACCTTCGACACCGGCTACTACCGCAACGTCGCCAAGCGGAGGGGGCTCTTCCAGTCTGACGCCGCACTCCTCACCGATGCCAGCACC
AGGGAATACGTCCAGCGCATCGCCACCGGCAAGTTTGACGACGTGTTCTTCAAGGACTTCAGCGAGTCCATGATCAAGATGGGAAATGTCGGTGTGCTCACCGGAGTTGATGGGGAGATC
AGGAAGAAGTGCTACATCGTTAAC

Retrieve as FASTA