Entry information : SiPrx33 (Si006893m)
Entry ID 9531
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx33 (Si006893m)
Name (synonym) SiPrx33 (Si006893m)
Class Class III peroxidase    [Orthogroup: Prx027]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx33
start..stop
S start..stop
SbPrx138 560 0 1..325 1..325
OsPrx86 558 0 29..325 28..324
TaPrx32 548 0 1..325 1..322
BdiPrx23 525 0 1..325 1..319
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 28524928..28525161 234 N° 2 28524560..28524751 192 N° 3 28523864..28524412 549  
complement(join(28523864..28524412,28524560..28524751,28524928..28525161))


exon

Literature and cross-references SiPrx33 (Si006893m)
DNA ref. Phytozome 12:   scaffold_4 (28525161..28523864)
Protein sequence: SiPrx33 (Si006893m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (295)
PWM (Da):   %s   34497.2 (31554.6) Transmb domain:   %s   i7-29o
PI (pH):   %s   8.58 (8.58) Peptide Signal:   %s   cut: 31 range:31-325
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MATFTRSSSTAAVLALAAVVLAVLGGAVEAQQLAPNFYSRTCPNLARIVRRGMASAVQKERRMGASILRMFFHDCFVNGCDGSILLDDTSTFTGEKGAGPNANSVRGFEVIDAIKAQVEASCTATVSCADILALAARDGVNLLGGPTWSVPLGRKDSRTASQSAANDNLPGPGSSLSTLISMFGNQGLSARDMTALSGAHTIGRSQCQFFRSRIYTEPNVNASFAALRQRTCPRSGGDANLAPFDVQTPDGFDNAYYQNLLQQKGLLHSDQELFNGGSQDALVRQYSNNPALFSSDFVTAMIKMGNLLPSAGTRTEVRLNCRKVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCACGTTCACGAGGTCGTCGTCCACGGCGGCCGTCCTCGCTCTCGCCGCCGTCGTCCTCGCCGTCCTCGGCGGCGCGGTGGAGGCGCAGCAGCTGGCGCCCAACTTCTACTCCCGG
ACGTGCCCCAACCTGGCCAGGATCGTGCGGCGGGGAATGGCCTCCGCCGTGCAGAAGGAGAGGCGCATGGGCGCCTCCATCCTCCGCATGTTCTTCCACGACTGCTTCGTCAAT
GTAAGA
GCTACTAGATAGCAACCCTCCCAGGCGGCGGTGCCGTGGCGTGCCTGGCCCCGTGCTGCCGCCTGTCTGCTAGGTGCTAGCTAGCCGCCTAGCTGTACTGGACTGCGTGCCACCGATCAA
GAACGTGGGTGGGTGTGCTGACGTCGATCATTGCCCTGTTTTGTCGGCAGGGATGCGACGGCTCGATCCTGTTGGACGACACGTCGACCTTCACCGGCGAGAAGGGCGCCGGCCCCAACG
CCAACTCGGTGCGCGGCTTCGAGGTCATCGACGCCATCAAGGCCCAGGTCGAGGCCTCCTGCACGGCCACCGTCTCCTGCGCCGACATCCTCGCCCTCGCCGCCCGCGACGGCGTCAACC
TG
GTAAGCTCACTATCACACCTTATCATCATTCATCAACGCCGACCGACCAACCTGTCGACTGTCGTATGTGCCAACCGCTTACTCCTCGCTTTACACGTCGTACACACGTGGCTAACCG
CCAACTTCGGGTTCCTGATGCGTGTGCAGCTGGGCGGCCCGACGTGGAGCGTGCCGCTGGGCCGGAAGGACTCGCGCACGGCGAGCCAGAGCGCGGCCAACGACAACCTCCCCGGCCCGG
GGTCCAGCCTCTCGACGCTCATCTCCATGTTCGGGAACCAGGGCCTGTCGGCGCGGGACATGACGGCGCTGTCGGGGGCGCACACCATCGGGCGGTCGCAGTGCCAGTTCTTCCGGAGCC
GCATCTACACGGAACCCAACGTCAACGCCTCCTTCGCGGCGCTCCGGCAGCGGACGTGCCCGCGCTCGGGGGGCGACGCCAACCTCGCGCCGTTCGACGTGCAGACCCCCGACGGGTTCG
ACAACGCCTACTACCAGAACCTGCTGCAGCAGAAGGGGCTCCTCCACTCGGACCAGGAGCTCTTCAACGGCGGGTCGCAGGACGCGCTGGTCAGGCAGTACAGCAACAACCCGGCGCTGT
TCAGCAGCGACTTTGTCACGGCCATGATCAAGATGGGAAACCTGCTGCCGTCGGCAGGGACCAGGACGGAGGTCAGGCTCAACTGCAGGAAGGTCAAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCCACGTTCACGAGGTCGTCGTCCACGGCGGCCGTCCTCGCTCTCGCCGCCGTCGTCCTCGCCGTCCTCGGCGGCGCGGTGGAGGCGCAGCAGCTGGCGCCCAACTTCTACTCCCGG
ACGTGCCCCAACCTGGCCAGGATCGTGCGGCGGGGAATGGCCTCCGCCGTGCAGAAGGAGAGGCGCATGGGCGCCTCCATCCTCCGCATGTTCTTCCACGACTGCTTCGTCAAT
GGATGC
GACGGCTCGATCCTGTTGGACGACACGTCGACCTTCACCGGCGAGAAGGGCGCCGGCCCCAACGCCAACTCGGTGCGCGGCTTCGAGGTCATCGACGCCATCAAGGCCCAGGTCGAGGCC
TCCTGCACGGCCACCGTCTCCTGCGCCGACATCCTCGCCCTCGCCGCCCGCGACGGCGTCAACCTG
CTGGGCGGCCCGACGTGGAGCGTGCCGCTGGGCCGGAAGGACTCGCGCACGGCG
AGCCAGAGCGCGGCCAACGACAACCTCCCCGGCCCGGGGTCCAGCCTCTCGACGCTCATCTCCATGTTCGGGAACCAGGGCCTGTCGGCGCGGGACATGACGGCGCTGTCGGGGGCGCAC
ACCATCGGGCGGTCGCAGTGCCAGTTCTTCCGGAGCCGCATCTACACGGAACCCAACGTCAACGCCTCCTTCGCGGCGCTCCGGCAGCGGACGTGCCCGCGCTCGGGGGGCGACGCCAAC
CTCGCGCCGTTCGACGTGCAGACCCCCGACGGGTTCGACAACGCCTACTACCAGAACCTGCTGCAGCAGAAGGGGCTCCTCCACTCGGACCAGGAGCTCTTCAACGGCGGGTCGCAGGAC
GCGCTGGTCAGGCAGTACAGCAACAACCCGGCGCTGTTCAGCAGCGACTTTGTCACGGCCATGATCAAGATGGGAAACCTGCTGCCGTCGGCAGGGACCAGGACGGAGGTCAGGCTCAAC
TGCAGGAAGGTCAAC

Retrieve as FASTA