Entry information : SiPrx37 (Si006946m)
Entry ID 9535
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx37 (Si006946m)
Name (synonym) SiPrx37 (Si006946m)
Class Class III peroxidase    [Orthogroup: Prx109]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx37
start..stop
S start..stop
ZmPrx48 568 0 1..311 1..313
SbPrx135 560 0 1..311 1..313
SbPrx134 560 0 1..311 1..314
CciPrx01 551 0 1..311 1..307
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 28424163..28424369 207 N° 2 28424515..28424694 180 N° 3 28424796..28425341 546  
join(28424163..28424369,28424515..28424694,28424796..28425341)


exon

Literature and cross-references SiPrx37 (Si006946m)
DNA ref. Phytozome 12:   scaffold_4 (28424163..28425341)
Protein sequence: SiPrx37 (Si006946m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   312 (289)
PWM (Da):   %s   32813.22 (30472.0)  
PI (pH):   %s   8.14 (8.20) Peptide Signal:   %s   cut: 23 range:23-311
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAAPTLMQCLLAISLLSFAAHAQLSTMFYASSCPNLQGIVRAAMTQAINNEPRMGASLLRLFFHDCFVQGCDASILLDAGGEKSAGPNANSVRGYEVIDTIKKNVEAACPGVVSCADIVALAARDGTNLLGGPTWNVPLGRRDSTTASASLANQNLPPPTASLGTLISLFGRQGLSARDMTALSGAHTIGQARCTTFRGRIYGDTDINASFAALRQQTCPRSGGDGNLAPMDLQTPARFDNAYYTNLLSQRGLFHSDQELFNGGSQDALVRQYSSSPSQFNSDFVAAMIKMGNIGAGNAGQIRRNCRVVNS*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCTCCTACCTTGATGCAGTGCTTGCTCGCCATCTCCCTGCTCTCCTTCGCCGCCCACGCGCAGCTCTCGACGATGTTCTACGCGTCCTCCTGCCCCAACCTGCAGGGCATCGTG
CGGGCGGCCATGACCCAAGCCATCAACAATGAGCCTAGGATGGGCGCCTCCCTGCTCAGGCTCTTCTTCCACGACTGCTTCGTGCAA
GTGCGTCCTAGAACTCTCTCACTATCTTCGAGT
TCTGAACAAATCACAACGATTATTAACAATAGACTATTTGGTCCATTCTGAACAATTCAATGTAACAGCATGATAACATGCATCGATCCTAATTAATGTGTGATGATGACAGGGTTGCGA
CGCCTCGATCCTTCTCGACGCCGGAGGGGAGAAGTCCGCCGGCCCGAACGCGAACTCGGTGCGCGGCTATGAGGTCATCGACACCATCAAGAAGAACGTCGAGGCTGCGTGCCCCGGCGT
CGTGTCGTGCGCCGACATCGTCGCTCTCGCCGCGCGCGACGGGACGAATCTT
GTATGTAATTTACATTTACACATGCCCATCAAATGGTTCAGTGTGAGGCTAATTAAGGGACATGCATC
TGAAACTTTTTTTTGTCTTGTTGTGCGACGCAGCTCGGCGGGCCGACCTGGAACGTGCCGCTGGGCCGGCGCGACTCGACGACGGCGAGCGCGTCCCTCGCCAACCAGAACCTGCCGCCG
CCGACGGCGAGCCTCGGGACGCTCATCTCCCTGTTCGGCCGGCAGGGCCTCTCGGCTCGCGACATGACGGCGCTGTCGGGCGCGCACACCATCGGGCAGGCCCGGTGCACGACCTTCCGC
GGCCGCATCTATGGTGACACCGACATCAACGCCTCCTTCGCGGCGCTCCGGCAGCAGACGTGCCCGCGGTCGGGCGGCGACGGCAACCTGGCGCCCATGGACCTGCAGACGCCGGCGAGG
TTCGACAACGCCTACTACACGAACCTGCTGTCGCAGCGGGGCCTGTTCCACTCGGACCAGGAGCTCTTCAACGGCGGGTCGCAGGACGCGCTGGTGAGGCAGTACAGCAGCAGCCCGTCG
CAGTTCAACAGCGACTTCGTGGCGGCCATGATCAAGATGGGCAACATTGGGGCCGGCAACGCCGGACAGATCAGGCGCAACTGCCGGGTCGTCAACAGC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCTCCTACCTTGATGCAGTGCTTGCTCGCCATCTCCCTGCTCTCCTTCGCCGCCCACGCGCAGCTCTCGACGATGTTCTACGCGTCCTCCTGCCCCAACCTGCAGGGCATCGTG
CGGGCGGCCATGACCCAAGCCATCAACAATGAGCCTAGGATGGGCGCCTCCCTGCTCAGGCTCTTCTTCCACGACTGCTTCGTGCAA
GGTTGCGACGCCTCGATCCTTCTCGACGCCGGA
GGGGAGAAGTCCGCCGGCCCGAACGCGAACTCGGTGCGCGGCTATGAGGTCATCGACACCATCAAGAAGAACGTCGAGGCTGCGTGCCCCGGCGTCGTGTCGTGCGCCGACATCGTCGCT
CTCGCCGCGCGCGACGGGACGAATCTT
CTCGGCGGGCCGACCTGGAACGTGCCGCTGGGCCGGCGCGACTCGACGACGGCGAGCGCGTCCCTCGCCAACCAGAACCTGCCGCCGCCGACG
GCGAGCCTCGGGACGCTCATCTCCCTGTTCGGCCGGCAGGGCCTCTCGGCTCGCGACATGACGGCGCTGTCGGGCGCGCACACCATCGGGCAGGCCCGGTGCACGACCTTCCGCGGCCGC
ATCTATGGTGACACCGACATCAACGCCTCCTTCGCGGCGCTCCGGCAGCAGACGTGCCCGCGGTCGGGCGGCGACGGCAACCTGGCGCCCATGGACCTGCAGACGCCGGCGAGGTTCGAC
AACGCCTACTACACGAACCTGCTGTCGCAGCGGGGCCTGTTCCACTCGGACCAGGAGCTCTTCAACGGCGGGTCGCAGGACGCGCTGGTGAGGCAGTACAGCAGCAGCCCGTCGCAGTTC
AACAGCGACTTCGTGGCGGCCATGATCAAGATGGGCAACATTGGGGCCGGCAACGCCGGACAGATCAGGCGCAACTGCCGGGTCGTCAACAGC

Retrieve as FASTA