Entry information : SiPrx42 (Si008411m)
Entry ID 9540
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-12-14 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-07 (Qiang Li)
Peroxidase information: SiPrx42 (Si008411m)
Name (synonym) SiPrx42 (Si008411m)
Class Class III peroxidase    [Orthogroup: Prx132]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx42
start..stop
S start..stop
SbPrx132 580 0 4..372 7..406
ZmPrx23 556 0 18..372 36..421
BdiPrx29 493 3e-176 2..372 6..370
OsPrx79 493 6e-176 18..367 31..373
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 19301454..19301504 51 N° 2 19301289..19301426 138 N° 3 19300267..19301193 927  
complement(join(19300267..19301193,19301289..19301426,19301454..19301504))


exon

Literature and cross-references SiPrx42 (Si008411m)
DNA ref. Phytozome 12:   scaffold_4 (19301504..19300267)
Protein sequence: SiPrx42 (Si008411m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   372 (353)
PWM (Da):   %s   40961.28 (38900.1)  
PI (pH):   %s   5.26 (5.11) Peptide Signal:   %s   cut: 20 range:20-372
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MLSLFLFALLASAAQRSLQVGFYGQSCPEAEATISDIVNNEIAMDRGISPGLIRLFFHDCFITGCDASILLDESPAGDVPEKESSANGFTLVGLRTIDIAKSTLESMCPRTVSCADILAFAARDAAVAAGLPSYDVAAGRRDGMRSNMDDLPGNFPVPGHHVPRLTELFSQRGLSQEDMVVLSGAHSIGGAHCFMFSNRIYGFSEEADVDPSLDPEFAARLRQVCPPRNPDDDPQQAPKVKFDSQTGEKLDSAYYSELLARRGLLTSDNALIEDPQTRAMVEAFAGDDAMWQQKFAEAMQRVGMLDVLIGEGKGQVRKQCRLVNGQEQQQQPQLPWFRHQQRLPWSRQRRPRRPFPHHPVADLINGFFRGFH

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGTCGCTGTTCCTTTTCGCCCTGCTCGCGTCGGCGGCCCAGCGGAGCGCCGTCGACGCGTTGATCGTCGACGGCCTGCAGGTGGGGTTCTATGGCCAGTCGTGCCCAGAGGCCGAG
GCAACCATCAGCGACATCGTCAACAACGAGATCGCCATGGACCGCGGCATCTCCCCCGGCCTCATCCGGCTATTCTTCCACGATTGCTTCATCACG
GTAACAGGCATTTCCTGATCATGT
GTTGGCTGACGTGCACACAACACCCTGTCGTGACCGTTCGTGTACCGCCGGCGGCCGGTCTGCGCGTGCAGGGCTGCGACGCTTCCATCCTCCTGGACGAGTCGCCGGCAGGCGACGTCC
CGGAGAAGGAGTCGTCGGCCAACGGGTTCACCCTCGTCGGCCTCCGGACCATCGACATCGCCAAGTCGACCCTCGAGTCCATGTGCCCGCGCACGGTCTCCTGCGCGGACATCCTCGCCT
TCGCGGCGCGGGACGCCGCCGTGGCTGCGGGCCTCCCCAGCTACGACGTCGCGGCGGGGCGGCGCGACGGCATGCGCTCCAACATGGACGACCTCCCGGGCAACTTCCCCGTGCCGGGCC
ACCACGTCCCGCGCCTCACGGAGCTCTTCAGCCAGCGGGGGCTCTCCCAGGAGGACATGGTGGTGCTCTCCGGCGCGCACTCCATCGGCGGCGCCCACTGCTTCATGTTCTCCAACCGCA
TCTACGGCTTCTCCGAGGAGGCCGATGTGGACCCTTCGCTGGACCCGGAGTTCGCGGCGCGGCTCCGGCAGGTGTGCCCGCCGCGGAACCCCGACGACGACCCGCAGCAGGCGCCCAAGG
TGAAGTTCGACTCGCAGACGGGGGAGAAGCTCGACAGCGCCTACTACTCGGAGCTGCTCGCCAGGCGCGGCCTGCTGACCTCGGACAACGCGCTCATCGAGGACCCGCAGACGAGGGCGA
TGGTGGAGGCCTTCGCCGGGGACGACGCCATGTGGCAGCAGAAATTTGCGGAGGCGATGCAGAGGGTCGGCATGCTCGACGTGCTCATCGGCGAGGGCAAGGGCCAGGTGAGGAAGCAGT
GCCGCCTGGTGAACGGGCAGGAGCAGCAGCAGCAGCCGCAGCTTCCCTGGTTCCGGCACCAGCAGCGGCTGCCGTGGTCCCGTCAGCGGCGGCCGCGTCGACCGTTCCCGCACCACCCGG
TGGCCGATCTGATCAACGGGTTCTTCCGCGGGTTCCAC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGCTGTCGCTGTTCCTTTTCGCCCTGCTCGCGTCGGCGGCCCAGCGGAGCCTGCAGGTGGGGTTCTATGGCCAGTCGTGCCCAGAGGCCGAGGCAACCATCAGCGACATCGTCAACAAC
GAGATCGCCATGGACCGCGGCATCTCCCCCGGCCTCATCCGGCTATTCTTCCACGATTGCTTCATCACG
GGCTGCGACGCTTCCATCCTCCTGGACGAGTCGCCGGCAGGCGACGTCCCG
GAGAAGGAGTCGTCGGCCAACGGGTTCACCCTCGTCGGCCTCCGGACCATCGACATCGCCAAGTCGACCCTCGAGTCCATGTGCCCGCGCACGGTCTCCTGCGCGGACATCCTCGCCTTC
GCGGCGCGGGACGCCGCCGTGGCTGCGGGCCTCCCCAGCTACGACGTCGCGGCGGGGCGGCGCGACGGCATGCGCTCCAACATGGACGACCTCCCGGGCAACTTCCCCGTGCCGGGCCAC
CACGTCCCGCGCCTCACGGAGCTCTTCAGCCAGCGGGGGCTCTCCCAGGAGGACATGGTGGTGCTCTCCGGCGCGCACTCCATCGGCGGCGCCCACTGCTTCATGTTCTCCAACCGCATC
TACGGCTTCTCCGAGGAGGCCGATGTGGACCCTTCGCTGGACCCGGAGTTCGCGGCGCGGCTCCGGCAGGTGTGCCCGCCGCGGAACCCCGACGACGACCCGCAGCAGGCGCCCAAGGTG
AAGTTCGACTCGCAGACGGGGGAGAAGCTCGACAGCGCCTACTACTCGGAGCTGCTCGCCAGGCGCGGCCTGCTGACCTCGGACAACGCGCTCATCGAGGACCCGCAGACGAGGGCGATG
GTGGAGGCCTTCGCCGGGGACGACGCCATGTGGCAGCAGAAATTTGCGGAGGCGATGCAGAGGGTCGGCATGCTCGACGTGCTCATCGGCGAGGGCAAGGGCCAGGTGAGGAAGCAGTGC
CGCCTGGTGAACGGGCAGGAGCAGCAGCAGCAGCCGCAGCTTCCCTGGTTCCGGCACCAGCAGCGGCTGCCGTGGTCCCGTCAGCGGCGGCCGCGTCGACCGTTCCCGCACCACCCGGTG
GCCGATCTGATCAACGGGTTCTTCCGCGGGTTCCAC

Retrieve as FASTA