Entry information : SiPrx43 (Si008422m)
Entry ID 9541
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-12-12 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-12 (Qiang Li)
Peroxidase information: SiPrx43 (Si008422m)
Name (synonym) SiPrx43 (Si008422m)
Class Class III peroxidase    [Orthogroup: Prx149]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx43
start..stop
S start..stop
BdiPrx24 473 8e-170 14..315 15..318
OsPrx87 463 6e-166 20..315 26..327
SbPrx137 457 9e-164 1..315 1..318
ZmPrx76 443 3e-158 1..315 1..318
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 28508475..28508690 216 N° 2 28508150..28508341 192 N° 3 28508014..28508049 36 N° 4 28507500..28507919 420
complement(join(28507500..28507919,28508014..28508049,28508150..28508341,2850847 5..28508690))


exon

Literature and cross-references SiPrx43 (Si008422m)
DNA ref. Phytozome 12:   scaffold_4 (28508690..28507500)
Protein sequence: SiPrx43 (Si008422m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   315 (292)
PWM (Da):   %s   33092.02 (30676.8)  
PI (pH):   %s   10.87 (10.97) Peptide Signal:   %s   cut: 24 range:24-315
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MGTSFARSFALLALLCLLLPCHGKGKLSTKFYAKSCPGVATIVRSVMAQALAKEPRMGASIIRLFFHDCFVNGCDASILLDDTATFTGEKNAGANANSVRGYEVIDAIKTQVEAACNGTVSCADIVALASRDAVNLLGGPTWNVQLGRKDSRTASPSAANANLPGPGSSAASLVSAFAAQKGLSARDMTALSGAHTVGRARCLFFRGRIYGEPNINATFAAARSRRARRAAATATSRRSTTRRRTLRQRLLHEPGLLHSDQELFNGGPADALVRKYSGNAGMFANDFAKAMVKMGGLMPAAGTPTEVRLNCRKVN

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGGCACCTCGTTCGCTAGGAGCTTCGCTCTCCTTGCTCTTCTCTGCCTGCTTCTCCCGTGCCATGGCAAGGGGAAGCTCTCGACCAAGTTCTACGCCAAGTCGTGCCCCGGCGTGGCC
ACCATCGTGCGGTCCGTGATGGCGCAGGCCCTCGCCAAGGAGCCCCGGATGGGCGCGTCCATCATCCGGCTCTTCTTCCACGACTGCTTCGTCAAT
GTCGGTCACACATTTACTATCCTA
TTTTCATCTTGTTATAGGTGGCCTTGGCTTGCTTCTCGGTGATCACTGATCAGCTCATCAGGCTTTAGTGTGCACTGAGTCACTGATATGTTGGTGCGTGTGTGCACAGGGGTGTGACGC
GTCCATCCTTCTGGACGACACGGCCACGTTCACCGGCGAGAAGAATGCCGGCGCCAACGCCAACTCCGTCCGCGGGTACGAGGTGATCGACGCCATCAAGACGCAGGTAGAAGCGGCCTG
CAATGGCACCGTGTCGTGCGCTGACATCGTCGCCTTGGCATCTCGTGACGCCGTAAATTTG
GTCAGTACGTCTAGTGCTAACAGAGAACACGTACAACGATCCAATGCCCAGCACTACTG
CAAGTCTCTGCACGCCTAACTCTGATCCGCATGCGCTGCAGCTCGGAGGCCCGACGTGGAACGTGCAGCTCGGCCGGAAGGACTCGCGCACGGCGAGCCCGAGTGCCGCCAACGCCAACC
TGCCCGGTCCGGGCTCCAGCGCCGCGTCCCTCGTCTCGGCGTTCGCCGCCCAAAGGCCTCTCGGCGCGCGACATGACGGCGCTCTCCGGCGCGCACACCGTGGGGCGGGCGCGGTGCCTC
TTCTTCCGCGGCCGCATCTACGGTGAGCCCAACATCAACGCCACCTTCGCGGCGGCGCGCAGCAGACGTGCCCGCAGAGCGGCGGCGACGGCAACCTCGCGCCGTTCGACGACCAGACGC
CGGACGCTTCGACAACGCCTACTACACGAACCTGGTGGCGCAGCGCGGCTGCTGCACTCCGACCAGGAGCTCTTCAACGGCGGGCCGGCGGACGCGCTGGTGAGGAAGTACAGCGGCAAT
GCCGGCATGTTCGCCAACGACTTCGCCAAGGCGATGGTGAAGATGGGCGGCCTTATGCCGGCGGCTGGGACGCCGACGGAGGTCAGGTTGAACTGCCGGAAAGTGAACTAG

Retrieve as FASTA