Entry information : SiPrx45 (Si010419m)
Entry ID 9543
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-12-12 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-07 (Qiang Li)
Peroxidase information: SiPrx45 (Si010419m)
Name (synonym) SiPrx45 (Si010419m)
Class Class III peroxidase    [Orthogroup: Prx013]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx45
start..stop
S start..stop
SbPrx116 562 0 1..350 9..363
ZmPrx39 551 0 3..350 4..357
SbPrx115 546 0 20..350 20..357
ZmPrx03_Du101 545 0 3..350 3..357
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 32277490..32277699 210 N° 2 32276946..32277377 432 N° 3 32276434..32276844 411  
complement(join(32276434..32276844,32276946..32277377,32277490..32277699))


exon

Literature and cross-references SiPrx45 (Si010419m)
DNA ref. Phytozome 12:   scaffold_7 (32277699..32276434)
Protein sequence: SiPrx45 (Si010419m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   350 (326)
PWM (Da):   %s   36998.56 (34639.3) Transmb domain:   %s   i7-29o
PI (pH):   %s   7.28 (6.65) Peptide Signal:   %s   cut: 25 range:25-350
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MARRSLSLASVLAALLSATAVCACLEVGFYDRTCPSAETVVQQTVAAAFRNNSGVAPALIRLHFHDCFVRGCDCSVLIDSTANNTAEKDSPPNNPSLRFFDVVDRAKAAVEARCPGVVSCADVLAFAARDGVALAGGLGYQVPAGRRDGRVSLAAEAFNELPPPSFNATELLDSFASKNLTLEDMVVLSGAHSIGVSHCIHFFDRLYNVTNTTDIDPALSKAYAFLLQCICPRNTGQFFPNTTTFMDLITPTKLDNKYYVGLTNNLGLFQSDAALLTNATMKALVDSFIRSEATWKSKFARSMVKMGQIGVLSGTQGEIRRNCRAINPANAADVLAGPGSSAGFSGVAAS*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGGCGCTCCTTAAGCTTGGCTTCTGTCCTCGCGGCGCTCCTGTCGGCCACCGCCGTGTGCGCCTGCCTCGAGGTCGGCTTCTACGACAGGACGTGCCCATCCGCCGAGACCGTC
GTGCAGCAGACTGTCGCCGCCGCGTTCAGGAACAACTCCGGCGTCGCTCCGGCCCTCATCCGCCTGCACTTCCATGACTGCTTCGTCAGG
GTAAGTAGCAGCTAGTTCCTTTTAAGCTTG
AACTTACGTGTTCAAAAGCGGCATCTATCTGAGAATGGAAGAAGCACCCTGATCGAGAAATACATACTCGATCTCCTTGCAGGGCTGCGACTGCTCGGTGCTGATCGACTCGACGGCGAA
CAACACGGCGGAGAAGGACTCGCCACCCAACAACCCGAGCCTCCGGTTCTTCGACGTGGTCGACCGCGCCAAGGCGGCCGTCGAGGCCCGGTGCCCCGGCGTGGTCTCCTGCGCTGACGT
CCTCGCCTTCGCGGCGCGGGACGGCGTCGCGCTCGCCGGCGGCCTCGGCTACCAGGTGCCTGCCGGCCGCCGCGACGGCCGGGTATCCCTTGCGGCGGAGGCGTTCAACGAACTGCCCCC
GCCGTCTTTCAACGCCACCGAGCTGCTGGACAGCTTCGCCTCCAAGAACCTCACCCTTGAGGACATGGTCGTCCTCTCCGGCGCCCACTCCATCGGCGTCTCTCACTGCATCCACTTCTT
CGACCGGCTCTACAACGTCACCAACACAACCGAC
GGAGTAAACCATTACTGCATTTACGATTAATATATGTATAAATTAGGATTTGTTTGAAGCATACAGTCTTTATTCACGCATTGCTG
TTGTTGTGTGTGCAAATCGATCCGGCTTTGAGCAAGGCCTACGCATTTCTACTCCAGTGCATCTGCCCGAGGAACACGGGCCAGTTCTTCCCGAACACGACGACGTTCATGGACCTCATC
ACGCCGACGAAGCTCGACAACAAGTACTACGTCGGCCTGACCAACAACCTGGGCCTCTTCCAGTCGGACGCGGCGCTGCTGACCAACGCGACCATGAAGGCGCTGGTCGACTCCTTCATC
CGCAGCGAGGCCACGTGGAAGAGCAAGTTCGCCAGGTCCATGGTCAAGATGGGGCAGATCGGCGTGCTGTCCGGAACGCAGGGGGAGATCAGGCGCAACTGCAGGGCCATCAACCCTGCT
AATGCTGCCGATGTCCTCGCCGGGCCAGGATCTTCAGCAGGGTTCAGTGGAGTGGCAGCAAGCTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGAGGCGCTCCTTAAGCTTGGCTTCTGTCCTCGCGGCGCTCCTGTCGGCCACCGCCGTGTGCGCCTGCCTCGAGGTCGGCTTCTACGACAGGACGTGCCCATCCGCCGAGACCGTC
GTGCAGCAGACTGTCGCCGCCGCGTTCAGGAACAACTCCGGCGTCGCTCCGGCCCTCATCCGCCTGCACTTCCATGACTGCTTCGTCAGG
GGCTGCGACTGCTCGGTGCTGATCGACTCG
ACGGCGAACAACACGGCGGAGAAGGACTCGCCACCCAACAACCCGAGCCTCCGGTTCTTCGACGTGGTCGACCGCGCCAAGGCGGCCGTCGAGGCCCGGTGCCCCGGCGTGGTCTCCTGC
GCTGACGTCCTCGCCTTCGCGGCGCGGGACGGCGTCGCGCTCGCCGGCGGCCTCGGCTACCAGGTGCCTGCCGGCCGCCGCGACGGCCGGGTATCCCTTGCGGCGGAGGCGTTCAACGAA
CTGCCCCCGCCGTCTTTCAACGCCACCGAGCTGCTGGACAGCTTCGCCTCCAAGAACCTCACCCTTGAGGACATGGTCGTCCTCTCCGGCGCCCACTCCATCGGCGTCTCTCACTGCATC
CACTTCTTCGACCGGCTCTACAACGTCACCAACACAACCGAC
ATCGATCCGGCTTTGAGCAAGGCCTACGCATTTCTACTCCAGTGCATCTGCCCGAGGAACACGGGCCAGTTCTTCCCG
AACACGACGACGTTCATGGACCTCATCACGCCGACGAAGCTCGACAACAAGTACTACGTCGGCCTGACCAACAACCTGGGCCTCTTCCAGTCGGACGCGGCGCTGCTGACCAACGCGACC
ATGAAGGCGCTGGTCGACTCCTTCATCCGCAGCGAGGCCACGTGGAAGAGCAAGTTCGCCAGGTCCATGGTCAAGATGGGGCAGATCGGCGTGCTGTCCGGAACGCAGGGGGAGATCAGG
CGCAACTGCAGGGCCATCAACCCTGCTAATGCTGCCGATGTCCTCGCCGGGCCAGGATCTTCAGCAGGGTTCAGTGGAGTGGCAGCAAGCTAA

Retrieve as FASTA