Entry information : SiPrx46 (Si010422m)
Entry ID 9544
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx46 (Si010422m)
Name (synonym) SiPrx46 (Si010422m)
Class Class III peroxidase    [Orthogroup: Prx013]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx46
start..stop
S start..stop
ZmPrx39 589 0 1..364 1..357
SbPrx116 585 0 8..364 12..363
SbPrx115 572 0 2..364 3..357
SiPrx47 566 0 1..364 1..362
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 32254721..32254933 213 N° 2 32254085..32254543 459 N° 3 32253407..32253826 420  
complement(join(32253407..32253826,32254085..32254543,32254721..32254933))


exon

Literature and cross-references SiPrx46 (Si010422m)
DNA ref. Phytozome 12:   scaffold_7 (32254933..32253407)
Protein sequence: SiPrx46 (Si010422m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   365 (339)
PWM (Da):   %s   38859.26 (36076.8) Transmb domain:   %s   i12-31o
PI (pH):   %s   7.34 (6.50) Peptide Signal:   %s   cut: 26 range:26-364
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MTRRCCVRFTTLLSLLAALLSATACLDFGFYDTRCPAAETIVQQTVAAAFRNDSGVAPAIIRMHFHDCFVRGCDGSVLIDSTTNPNNTAEKDAIPNKPSLRFFEVVDRAKAALEAQCPGVVSCADILAFAARDSVVLSGGLGYQVPAGRRDGRTSNATEALNQLPPPFFNATQLVDNFASKNLTLEDMVVLSGAHTLGVSHCDSFAGIGNLGDRIHNFSSSADGVDPSLSKAYALLLRSVCPSNSSQFFPTTTPFMDLITPNKFDNKYYVGLQNNLGLFISDAALMTNATMRTLVNSFVRSESTWKTKFAKSMLKMGQIEVMTGSQGEIRRNCRVVNPARTAGAHDDAVAGSSDSSGFTGVAAS*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTAGGCGCTGCTGCGTACGCTTCACCACGCTCCTCTCGCTCCTGGCGGCGCTGCTCTCGGCCACCGCCTGCCTCGACTTCGGCTTCTACGACACGAGATGCCCCGCCGCCGAGACC
ATCGTGCAGCAGACCGTCGCCGCCGCGTTCAGGAACGACTCCGGCGTCGCTCCGGCGATAATCCGCATGCACTTCCATGACTGCTTCGTCAGA
GTAAGCACATGCACATAAGAAAAGTTC
TGAAAAATATGATGAAATGGAAGTATTTTGCATAACAGTTCTAGATACCATTTCTATGTCACAAAGCTTAGCACTATTATTGTGAGGTCGCGAGGAAGTAAAGGAATTCACCTGAGAGTG
ACGGCACGGACGCTTAAACCTCCTTTGCAGGGCTGCGACGGCTCGGTGCTGATCGACTCGACGACGAACCCGAACAACACGGCGGAGAAGGATGCCATCCCCAACAAGCCGAGCCTCCGG
TTCTTCGAGGTGGTCGACCGCGCCAAGGCGGCTCTGGAGGCGCAGTGCCCCGGTGTGGTCTCCTGCGCAGACATTCTCGCCTTCGCGGCCCGGGACAGCGTCGTGCTCTCAGGCGGCCTC
GGCTACCAGGTGCCGGCCGGGCGCCGCGACGGCCGGACATCTAATGCAACCGAGGCGCTCAACCAGCTGCCCCCGCCGTTCTTCAACGCCACCCAACTGGTAGACAACTTCGCCTCCAAG
AACCTCACCCTTGAGGACATGGTTGTCCTCTCCGGCGCGCACACCCTCGGCGTCTCGCACTGCGACAGCTTCGCCGGTATCGGCAACCTCGGCGACCGGATCCACAACTTCAGCAGCTCA
GCTGACGGT
GTAAGCATATATACTTTATTTTCCTCTCCAAAAACTAGGATGCTGAAGGTTTTGGATTTGTCGTGAAACGTACTGCACTAGCTTATCAGTGTTTTTATTCACATGTTTTTA
CTAAAAGTTGTAGTCAGAAAACATTTTATCGAAGAGCCGACCCTGAAATATCAGAAACGAATTTTATATTTTTTTCATGTAGCATATACATATTTATCTACTATCTAGTGAAGATCTTAC
TCGGCCATCCATTGCTGCGGTTTACAGGTTGATCCGTCGCTGAGCAAGGCCTACGCACTTCTGCTCAGGAGCGTCTGCCCGTCCAACAGCAGCCAGTTCTTCCCAACGACGACGCCGTTC
ATGGACCTCATCACGCCGAACAAGTTCGACAACAAGTACTACGTGGGCCTGCAGAACAACCTTGGCCTCTTCATCTCGGACGCGGCGCTCATGACCAACGCGACGATGAGGACCCTGGTC
AACTCCTTCGTGCGCAGCGAGTCCACGTGGAAGACCAAGTTCGCCAAGTCCATGCTCAAGATGGGGCAGATCGAGGTGATGACCGGGAGTCAGGGCGAGATCAGGCGCAACTGCAGGGTC
GTCAACCCTGCTCGCACCGCCGGCGCCCATGACGATGCCGTCGCCGGGTCATCAGATTCTTCAGGATTCACTGGAGTAGCTGCAAGC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGACTAGGCGCTGCTGCGTACGCTTCACCACGCTCCTCTCGCTCCTGGCGGCGCTGCTCTCGGCCACCGCCTGCCTCGACTTCGGCTTCTACGACACGAGATGCCCCGCCGCCGAGACC
ATCGTGCAGCAGACCGTCGCCGCCGCGTTCAGGAACGACTCCGGCGTCGCTCCGGCGATAATCCGCATGCACTTCCATGACTGCTTCGTCAGA
GGCTGCGACGGCTCGGTGCTGATCGAC
TCGACGACGAACCCGAACAACACGGCGGAGAAGGATGCCATCCCCAACAAGCCGAGCCTCCGGTTCTTCGAGGTGGTCGACCGCGCCAAGGCGGCTCTGGAGGCGCAGTGCCCCGGTGTG
GTCTCCTGCGCAGACATTCTCGCCTTCGCGGCCCGGGACAGCGTCGTGCTCTCAGGCGGCCTCGGCTACCAGGTGCCGGCCGGGCGCCGCGACGGCCGGACATCTAATGCAACCGAGGCG
CTCAACCAGCTGCCCCCGCCGTTCTTCAACGCCACCCAACTGGTAGACAACTTCGCCTCCAAGAACCTCACCCTTGAGGACATGGTTGTCCTCTCCGGCGCGCACACCCTCGGCGTCTCG
CACTGCGACAGCTTCGCCGGTATCGGCAACCTCGGCGACCGGATCCACAACTTCAGCAGCTCAGCTGACGGT
GTTGATCCGTCGCTGAGCAAGGCCTACGCACTTCTGCTCAGGAGCGTC
TGCCCGTCCAACAGCAGCCAGTTCTTCCCAACGACGACGCCGTTCATGGACCTCATCACGCCGAACAAGTTCGACAACAAGTACTACGTGGGCCTGCAGAACAACCTTGGCCTCTTCATC
TCGGACGCGGCGCTCATGACCAACGCGACGATGAGGACCCTGGTCAACTCCTTCGTGCGCAGCGAGTCCACGTGGAAGACCAAGTTCGCCAAGTCCATGCTCAAGATGGGGCAGATCGAG
GTGATGACCGGGAGTCAGGGCGAGATCAGGCGCAACTGCAGGGTCGTCAACCCTGCTCGCACCGCCGGCGCCCATGACGATGCCGTCGCCGGGTCATCAGATTCTTCAGGATTCACTGGA
GTAGCTGCAAGC

Retrieve as FASTA