Entry information : SiPrx68 (Si015307m)
Entry ID 9559
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-12-14 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-07 (Qiang Li)
Peroxidase information: SiPrx68 (Si015307m)
Name (synonym) SiPrx68 (Si015307m)
Class Class III peroxidase    [Orthogroup: Prx028]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx68
start..stop
S start..stop
SbPrx103 554 0 1..358 1..371
ZmPrx32 548 0 1..358 1..368
TaPrx22-1A 514 0 29..356 22..348
BdiPrx105 498 2e-178 31..356 27..368
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 18831492..18831809 318 N° 2 18831195..18831389 195 N° 3 18830865..18831080 216 N° 4 18830647..18830834 188
N° 5 18830460..18830619 160  
complement(join(18830460..18830619,18830647..18830834,18830865..18831080,1883119 5..18831389,18831492..18831809))


exon

Literature and cross-references SiPrx68 (Si015307m)
DNA ref. Phytozome 12:   scaffold_6 (18831809..18830460)
Protein sequence: SiPrx68 (Si015307m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   359 (335)
PWM (Da):   %s   36625.34 (34179.0)  
PI (pH):   %s   4.99 (4.99) Peptide Signal:   %s   cut: 25 range:25-359
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAYSSTTVALQIVVGLLLALTVTTESGSAPVNTSCVTGSAGATVSIGYGGARASAGAGMSLGVGVYRATCPRAEEIVRAAIERAVAADPRMAASLLRLHFHDCFVNGCDGSVLLDDKPPFFIGEKTAVPNANSLRGFEVIDTIKAELERECPETVSCADLLAIAARDSVVVSGGPNWEVEAGRKDGRTASLQGANTNLPAPTSGVATLVQKFRNVGLSAKDMVALSGAHTIGKARCTSFSARLGGAVGAASKDMAFLQSLQQLCSGSAGSALAHLDLATPATFDNQYYINLLSGDGLLPSDQALASDDDGVAGLVATYAFDASVFFQDFAESMLRMGRLAPGGAGGEVRTNCRVVNSS

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTACTCCAGCACCACCGTGGCCCTGCAGATCGTCGTCGGCCTGCTGCTCGCGCTCACCGTCACCACCGAGTCCGGATCCGCTCCCGTCAACACGTCGTGCGTCACTGGCAGCGCC
GGCGCCACCGTGAGCATTGGCTACGGCGGGGCGAGAGCCAGCGCCGGGGCCGGCATGTCTCTTGGTGTCGGCGTGTACCGGGCCACCTGCCCCCGCGCCGAGGAGATCGTCCGCGCGGCC
ATCGAGAGGGCCGTCGCCGCCGACCCGCGCATGGCGGCGTCCCTCCTCCGCCTCCATTTCCACGACTGCTTTGTCAAC
GTAAGCTCACCACCCAGCTCCACCTGGTCCGACCGTCATTGA
CACGTACACTAGATTTTCCTGCAATGCAGTGACTTTATTTCCCTTTCTGTGTTTTCTCAGGGCTGCGACGGCTCCGTGCTCCTGGACGACAAGCCGCCCTTCTTCATCGGCGAGAAGACG
GCCGTGCCGAACGCCAACTCGCTCAGGGGCTTCGAGGTCATCGACACCATCAAGGCCGAGCTGGAGCGAGAGTGCCCAGAGACGGTCTCCTGCGCCGACCTCCTTGCCATCGCTGCCCGT
GACTCCGTCGTCGTG
GTAATTTAAGATACTAAAGCCCTATTAACATACATGAAGATGCAGTTAATTATCATATATACTTCTTCACAATCACATCCTGATCAAGTGATCATTGATCGCCGC
CCGGTCCAGTCGGGCGGGCCGAACTGGGAGGTAGAGGCCGGCCGGAAGGACGGCCGCACGGCGAGCCTCCAGGGCGCCAACACCAATCTCCCGGCGCCGACGTCCGGCGTCGCCACCCTC
GTGCAGAAGTTCAGGAACGTCGGCCTCTCCGCTAAGGACATGGTCGCTCTCTCCGGCGCGCACACCATCGGGAAGGCACGGTGCACATCGTTCAGCGCGCGCCTC
GTCTCCGGCGCCGGC
GCAGACGTTTCGGCCGGCGGCGCCGTTGGGGCGGCGTCCAAGGACATGGCCTTCCTGCAGTCGCTGCAGCAGCTGTGCTCGGGTTCAGCGGGGTCGGCGCTGGCGCACCTGGACCTCGCC
ACGCCGGCCACCTTCGACAACCAGTACTACATCAACCTCCTCTCCGGCGACGGCCTGCTGCCGTCCGACCAGGCGCTCGCGTC
GCCATCAGCAGGCGCCATGCCGGGGGCAGACGATGAC
GGCGTCGCCGGCCTCGTGGCCACCTACGCGTTCGACGCCTCCGTCTTCTTCCAGGACTTTGCGGAGTCCATGCTGCGTATGGGGAGGCTCGCGCCCGGTGGCGCCGGAGGCGAGGTCCGC
ACGAACTGCCGGGTGGTGAACAGCTCGAGC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTACTCCAGCACCACCGTGGCCCTGCAGATCGTCGTCGGCCTGCTGCTCGCGCTCACCGTCACCACCGAGTCCGGATCCGCTCCCGTCAACACGTCGTGCGTCACTGGCAGCGCC
GGCGCCACCGTGAGCATTGGCTACGGCGGGGCGAGAGCCAGCGCCGGGGCCGGCATGTCTCTTGGTGTCGGCGTGTACCGGGCCACCTGCCCCCGCGCCGAGGAGATCGTCCGCGCGGCC
ATCGAGAGGGCCGTCGCCGCCGACCCGCGCATGGCGGCGTCCCTCCTCCGCCTCCATTTCCACGACTGCTTTGTCAAC
GGCTGCGACGGCTCCGTGCTCCTGGACGACAAGCCGCCCTTC
TTCATCGGCGAGAAGACGGCCGTGCCGAACGCCAACTCGCTCAGGGGCTTCGAGGTCATCGACACCATCAAGGCCGAGCTGGAGCGAGAGTGCCCAGAGACGGTCTCCTGCGCCGACCTC
CTTGCCATCGCTGCCCGTGACTCCGTCGTCGTG
TCGGGCGGGCCGAACTGGGAGGTAGAGGCCGGCCGGAAGGACGGCCGCACGGCGAGCCTCCAGGGCGCCAACACCAATCTCCCGGCG
CCGACGTCCGGCGTCGCCACCCTCGTGCAGAAGTTCAGGAACGTCGGCCTCTCCGCTAAGGACATGGTCGCTCTCTCCGGCGCGCACACCATCGGGAAGGCACGGTGCACATCGTTCAGC
GCGCGCCTC
GGCGGCGCCGTTGGGGCGGCGTCCAAGGACATGGCCTTCCTGCAGTCGCTGCAGCAGCTGTGCTCGGGTTCAGCGGGGTCGGCGCTGGCGCACCTGGACCTCGCCACGCCG
GCCACCTTCGACAACCAGTACTACATCAACCTCCTCTCCGGCGACGGCCTGCTGCCGTCCGACCAGGCGCTCGCGTC
AGACGATGACGGCGTCGCCGGCCTCGTGGCCACCTACGCGTTC
GACGCCTCCGTCTTCTTCCAGGACTTTGCGGAGTCCATGCTGCGTATGGGGAGGCTCGCGCCCGGTGGCGCCGGAGGCGAGGTCCGCACGAACTGCCGGGTGGTGAACAGCTCGAGC

Retrieve as FASTA