Entry information : SiPrx75 (Si017767m)
Entry ID 9566
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-12-12 (Qiang Li)
Sequence status complete
Reviewer Not yet reviewed
Last annotation changes 2011-12-07 (Qiang Li)
Peroxidase information: SiPrx75 (Si017767m)
Name (synonym) SiPrx75 (Si017767m)
Class Class III peroxidase    [Orthogroup: Prx015]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx75
start..stop
S start..stop
ZmPrx136 528 0 26..322 30..328
SbPrx82 499 5e-180 26..322 32..328
OsPrx32 471 5e-169 10..322 13..322
BdiPrx114 424 2e-150 26..322 35..329
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 42052053..42052271 219 N° 2 42052369..42052764 396 N° 3 42052906..42053133 228  
join(42052053..42052271,42052369..42052764,42052906..42053133)


exon

Literature and cross-references SiPrx75 (Si017767m)
DNA ref. Phytozome 12:   scaffold_1 (42052053..42053133)
Protein sequence: SiPrx75 (Si017767m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   328 (300)
PWM (Da):   %s   33883.95 (31285.6)  
PI (pH):   %s   7.5 (7.78) Peptide Signal:   %s   cut: 28 range:28-327
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAMASPTTTVILMAVAAAAALLGGAEALSLDLYDETCPEAEAAVTAAVRQAMAKDRTVAAGLLRMHFHDCFVRGCDASVLLDSTANVTAEKDGPPNASLHAFYVIDNAKAAVEALCPGVVSCADILALAARDAVALSGGPSWVVPVGRRDGRVSLASETSSALPGPRASFDQLKQAFHARGLSTKDLVVLSGGHTLGFAHCSSFQDRIRSPNGGGGADPALSPSFAASLRRACPANNTARAAGSGLDATEAAFDNTYYRMLQTGRGLLGSDDALLTHPKTRAFVALYAASQEAFFRAFAKSMLRMGGLNGGDEVRANCRRVNHHLSN*

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAATGGCATCTCCTACTACTACAGTCATATTAATGGCCGTCGCGGCGGCGGCGGCGCTGCTGGGCGGCGCCGAGGCGCTGAGCCTGGACCTGTACGACGAGACGTGCCCGGAGGCG
GAGGCGGCGGTGACGGCGGCCGTGCGGCAGGCCATGGCCAAGGACCGCACCGTCGCGGCGGGGCTCCTGCGGATGCATTTCCACGACTGCTTCGTCAGG
GTGGGTAGATAGGAATCTCTC
TCTGTATTTCTTCTTCTTCTTCTTGTAGACGAAAAGGCTAAGCACTGACCACTGATGCATATGGCGGCCGGCATAGGGGTGCGACGCGTCCGTTCTCCTCGACTCCACGGCCAACGTCAC
GGCCGAGAAGGACGGCCCGCCCAACGCCTCTCTCCACGCCTTCTATGTCATCGACAACGCCAAGGCCGCCGTGGAGGCCCTCTGCCCCGGCGTCGTCTCCTGCGCCGACATCCTAGCGCT
CGCCGCCAGAGACGCCGTCGCCTTGTCCGGTGGGCCGTCCTGGGTGGTTCCCGTCGGCCGCCGGGACGGCCGTGTCTCCCTGGCCAGCGAGACGTCGTCGGCGCTGCCGGGGCCCAGGGC
CAGCTTCGACCAGCTCAAGCAGGCCTTCCACGCCCGGGGCCTCTCCACCAAGGACCTCGTCGTGCTGTCGGGCGGCCACACGCTGGGCTTCGCGCACTGCTCCTCCTTCCAG
GANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNTTCGACAACACCTACTACCGGATGCTGCAGACCGGGCGGGGCCTGCTGGGCTCCGACGACGCCCTGCTCACGCACCCCAAGACCAGGGCCTTCGTCGCGCTCTACGC
CGCGTCGCAGGAGGCCTTCTTCAGGGCCTTCGCCAAGTCCATGCTGCGGATGGGAGGACTCAACGGAGGGGACGAGGTGCGAGCAAACTGCAGGCGCGTCAACCACCACCTCTCCAACTA
G

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCAATGGCATCTCCTACTACTACAGTCATATTAATGGCCGTCGCGGCGGCGGCGGCGCTGCTGGGCGGCGCCGAGGCGCTGAGCCTGGACCTGTACGACGAGACGTGCCCGGAGGCG
GAGGCGGCGGTGACGGCGGCCGTGCGGCAGGCCATGGCCAAGGACCGCACCGTCGCGGCGGGGCTCCTGCGGATGCATTTCCACGACTGCTTCGTCAGG
GGGTGCGACGCGTCCGTTCTC
CTCGACTCCACGGCCAACGTCACGGCCGAGAAGGACGGCCCGCCCAACGCCTCTCTCCACGCCTTCTATGTCATCGACAACGCCAAGGCCGCCGTGGAGGCCCTCTGCCCCGGCGTCGTC
TCCTGCGCCGACATCCTAGCGCTCGCCGCCAGAGACGCCGTCGCCTTGTCCGGTGGGCCGTCCTGGGTGGTTCCCGTCGGCCGCCGGGACGGCCGTGTCTCCCTGGCCAGCGAGACGTCG
TCGGCGCTGCCGGGGCCCAGGGCCAGCTTCGACCAGCTCAAGCAGGCCTTCCACGCCCGGGGCCTCTCCACCAAGGACCTCGTCGTGCTGTCGGGCGGCCACACGCTGGGCTTCGCGCAC
TGCTCCTCCTTCCAG
TTCGACAACACCTACTACCGGATGCTGCAGACCGGGCGGGGCCTGCTGGGCTCCGACGACGCCCTGCTCACGCACCCCAAGACCAGGGCCTTCGTCGCGCTCTAC
GCCGCGTCGCAGGAGGCCTTCTTCAGGGCCTTCGCCAAGTCCATGCTGCGGATGGGAGGACTCAACGGAGGGGACGAGGTGCGAGCAAACTGCAGGCGCGTCAACCACCACCTCTCCAAC
TAG

Retrieve as FASTA