Entry information : SiPrx77 (Si017811m)
Entry ID 9568
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-10-03 (Qiang Li)
Sequence status complete
Reviewer Qiang Li
Last annotation changes 2011-12-15 (Qiang Li)
Peroxidase information: SiPrx77 (Si017811m)
Name (synonym) SiPrx77 (Si017811m)
Class Class III peroxidase    [Orthogroup: Prx025]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx77
start..stop
S start..stop
SbPrx74 553 0 3..320 2..325
BdiPrx99 524 0 7..320 6..319
ZmPrx123 520 0 3..320 2..323
HvPrx13 517 0 2..320 4..322
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 1975918..1976127 210 N° 2 1975629..1975820 192 N° 3 1974960..1975520 561  
complement(join(1974960..1975520,1975629..1975820,1975918..1976127))


exon

Literature and cross-references SiPrx77 (Si017811m)
DNA ref. Phytozome 11:   scaffold_1 (1976127..1974960)
Protein sequence: SiPrx77 (Si017811m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   322 (298)
PWM (Da):   %s   34045.23 (31431.9)  
PI (pH):   %s   6.97 (6.49) Peptide Signal:   %s   cut: 24 range:24-321
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MAASFRTWHCLVALLMLASVAQGQLSPSFYATTCPTLGLIVRATMIKALLLERRMGASLVRLFFHDCFVQGCDASILLDDVGSFVGEKGAGPNVNSVRGYEVIDQIKANVELLCPGVVSCADIVALAARDSTFLLGGPTWAVPLGRRDSTTASQSLANSDLPSPASDLATLITAFGNKGLSARDMTALSGAHTIGFSQCQNFRDHIYNDTDINPAFAALRRRTCPAAAGSGDGNLAPLDVTTQLLFDNAYYGNLLVRRGLLHSDQELFNGGSQDALVQQYSANPALFAADFVTAMIKMGSIRPLTGSAGQIRANCRVVNSR

Retrieve as FASTA  
Remarks Complete sequence from genomic.
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCTTCGTTCCGGACCTGGCATTGCTTGGTCGCCTTGCTCATGCTCGCTTCGGTGGCGCAGGGGCAGCTCTCGCCGTCGTTCTACGCGACGACCTGCCCGACGCTGGGTCTCATC
GTGCGCGCCACCATGATCAAGGCCCTCCTACTCGAGCGCCGGATGGGCGCCTCCCTCGTCAGGCTCTTCTTCCACGACTGCTTCGTCCAG
GTACACGTTGTTAATAACAACAACCCTGAA
TCCAGAGTGGTAATGGATCGAGACTGCCCGTGCATATGCTGAAATATGGTTTTGCTCTCGTCATCAGGGCTGCGACGCCTCGATTCTCCTGGACGACGTCGGCAGCTTCGTCGGCGAGAA
GGGCGCCGGCCCCAACGTCAACTCCGTCCGCGGCTACGAGGTCATCGACCAGATCAAGGCCAACGTCGAGCTCCTCTGCCCCGGCGTCGTCTCCTGCGCCGACATCGTCGCCCTCGCCGC
CCGAGACAGCACCTTCCTG
GTACACTGCACAAACACACGTGCATATATAGACACAGGCCAACGTGTACTATCAAAGTACACAATGCACTCACGCTGAGCGAAATCTAACACGATCAATAC
TGCACAGCTCGGAGGGCCAACCTGGGCGGTGCCGCTCGGCCGGCGCGACTCGACGACGGCGAGCCAGAGCCTGGCGAACAGCGACCTCCCGTCGCCGGCCTCCGACCTCGCCACCCTCAT
CACGGCGTTCGGCAACAAGGGCCTGAGCGCACGCGATATGACGGCGCTCTCCGGCGCGCACACCATCGGCTTCTCGCAGTGCCAGAACTTCCGCGACCACATCTACAACGACACCGACAT
CAACCCGGCGTTCGCGGCGCTGCGCCGGCGCACCTGCCCCGCGGCGGCGGGCAGCGGCGACGGCAACCTGGCGCCGCTCGACGTGACGACGCAGCTGCTCTTCGACAACGCCTACTACGG
GAACCTCCTCGTCAGGCGCGGCCTGCTGCACTCGGACCAGGAGCTTTTCAACGGCGGGTCGCAGGACGCGCTGGTGCAGCAGTACAGCGCCAACCCGGCCCTCTTCGCCGCCGACTTCGT
CACCGCCATGATAAAGATGGGAAGCATCCGCCCGCTCACCGGGAGCGCCGGCCAGATCAGGGCCAACTGCAGGGTGGTCAACAGCCGC

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGGCTTCGTTCCGGACCTGGCATTGCTTGGTCGCCTTGCTCATGCTCGCTTCGGTGGCGCAGGGGCAGCTCTCGCCGTCGTTCTACGCGACGACCTGCCCGACGCTGGGTCTCATC
GTGCGCGCCACCATGATCAAGGCCCTCCTACTCGAGCGCCGGATGGGCGCCTCCCTCGTCAGGCTCTTCTTCCACGACTGCTTCGTCCAG
GGCTGCGACGCCTCGATTCTCCTGGACGAC
GTCGGCAGCTTCGTCGGCGAGAAGGGCGCCGGCCCCAACGTCAACTCCGTCCGCGGCTACGAGGTCATCGACCAGATCAAGGCCAACGTCGAGCTCCTCTGCCCCGGCGTCGTCTCCTGC
GCCGACATCGTCGCCCTCGCCGCCCGAGACAGCACCTTCCTG
CTCGGAGGGCCAACCTGGGCGGTGCCGCTCGGCCGGCGCGACTCGACGACGGCGAGCCAGAGCCTGGCGAACAGCGAC
CTCCCGTCGCCGGCCTCCGACCTCGCCACCCTCATCACGGCGTTCGGCAACAAGGGCCTGAGCGCACGCGATATGACGGCGCTCTCCGGCGCGCACACCATCGGCTTCTCGCAGTGCCAG
AACTTCCGCGACCACATCTACAACGACACCGACATCAACCCGGCGTTCGCGGCGCTGCGCCGGCGCACCTGCCCCGCGGCGGCGGGCAGCGGCGACGGCAACCTGGCGCCGCTCGACGTG
ACGACGCAGCTGCTCTTCGACAACGCCTACTACGGGAACCTCCTCGTCAGGCGCGGCCTGCTGCACTCGGACCAGGAGCTTTTCAACGGCGGGTCGCAGGACGCGCTGGTGCAGCAGTAC
AGCGCCAACCCGGCCCTCTTCGCCGCCGACTTCGTCACCGCCATGATAAAGATGGGAAGCATCCGCCCGCTCACCGGGAGCGCCGGCCAGATCAGGGCCAACTGCAGGGTGGTCAACAGC
CGC

Retrieve as FASTA