Entry information : SiPrx93 (Seita.3G053000.1[2.2] / Si022615m[2.1])
Entry ID 9584
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2016-01-08 (Christophe Dunand)
Sequence status complete
Reviewer Achraf Jemmat
Last annotation changes 2016-01-08 (Achraf Jemmat)
Peroxidase information: SiPrx93 (Seita.3G053000.1[2.2] / Si022615m[2.1])
Name (synonym) SiPrx93 (Seita.3G053000.1[2.2] / Si022615m[2.1])
Class Class III peroxidase    [Orthogroup: Prx152]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx93
start..stop
S start..stop
SbPrx113 560 0 28..334 31..338
ZmPrx77 557 0 1..334 1..336
OsPrx69 519 0 14..334 18..332
BdiPrx78 462 4e-165 14..334 16..342
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 3356171..3356410 240 N° 2 3356533..3357297 765  
join(3356171..3356410,3356533..3357297)


exon

Literature and cross-references SiPrx93 (Seita.3G053000.1[2.2] / Si022615m[2.1])
DNA ref. Phytozome 12:   scaffold_3 (3356171..3357294)
Protein sequence: SiPrx93 (Seita.3G053000.1[2.2] / Si022615m[2.1])
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   334 (301)
PWM (Da):   %s   35729.25 (32278.5)  
PI (pH):   %s   9.35 (9.50) Peptide Signal:   %s   cut: 34 range:34-334
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MSSTTRAHQLPVHLVAAAVIVAWACCGFRSSEAQLQVGYYNYTCPGAESLIETIVHAAVRKDAGNGPGLIRLFFHDCFVRGCDASVLLDDPTGTPGNATVEKTAPPNFPSLRGFAVINRAKRVVERRCPRTVSCADIVAFAARDAARIMGGIRFAMPSGRLDGRVSSASEAIANLPPASFNLTQLVARFASKNLTAADVVTLSGAHSIGRSHCSSFSGRLYPQLDPAMNATLGAALRGRCPAATGRRDRVVDLDFKTPLQLDNQYYRNVQTHEVVFTSDQSLVDRNDTAALVALYAANRKLWSQQFAAAMVKMGSIEVLTGPPGEVRLKCNKVN*

Retrieve as FASTA  
Remarks Complete sequence from genomic (intron 1).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCTCCACTACCAGAGCTCATCAGCTCCCTGTACATCTCGTCGCAGCCGCCGTCATCGTGGCATGGGCGTGCTGCGGCTTCCGCTCGTCGGAGGCGCAGCTGCAGGTGGGCTACTAC
AACTACACCTGCCCGGGAGCCGAGAGCCTCATCGAGACCATCGTCCACGCCGCCGTCCGCAAGGACGCCGGCAACGGGCCAGGGCTCATCCGCCTCTTCTTCCACGACTGCTTCGTCAGG
GTACGTACGCATTGCTACTCTGTGCAATTCACACTAGCTTGTTCCATCATCACCATGGATTCATTCATTCATTCATTCATGTCCAATGCCAATGCCAATGCCAATGCCAACAATTAATGC
AGGGCTGCGACGCGTCGGTGCTGCTGGACGACCCCACGGGCACCCCGGGCAACGCGACGGTGGAGAAGACCGCGCCGCCCAACTTCCCCAGCCTCCGTGGCTTCGCCGTCATCAACCGCG
CCAAGCGCGTGGTGGAGCGCCGCTGCCCCAGGACCGTCTCCTGCGCCGACATCGTCGCCTTCGCGGCCCGCGACGCGGCCCGCATCATGGGCGGCATCAGGTTCGCCATGCCCTCCGGCC
GCCTCGACGGCCGCGTCTCCAGCGCCTCCGAGGCCATCGCCAACCTTCCGCCGGCCTCCTTCAACCTCACCCAGCTCGTCGCCCGCTTCGCGTCCAAGAACCTCACCGCCGCCGACGTGG
TCACCCTCTCCGGCGCCCACTCCATCGGCCGCTCCCACTGCTCCTCCTTCTCCGGCCGCCTGTACCCGCAGCTCGACCCCGCCATGAACGCCACGCTCGGCGCCGCGCTCCGGGGTAGGT
GCCCCGCCGCCACGGGCCGGCGCGACCGCGTCGTGGACCTCGACTTCAAGACGCCGCTGCAGCTGGACAACCAGTACTACCGGAACGTGCAGACCCACGAGGTGGTGTTCACGTCGGACC
AGTCGCTCGTCGACCGCAACGACACGGCGGCGCTCGTCGCGCTCTACGCCGCCAACCGGAAGCTCTGGTCGCAGCAGTTCGCCGCCGCCATGGTGAAGATGGGCAGCATCGAGGTGCTCA
CCGGGCCGCCAGGGGAGGTCAGGCTCAAGTGCAACAAGGTCAACTAA

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGAGCTCCACTACCAGAGCTCATCAGCTCCCTGTACATCTCGTCGCAGCCGCCGTCATCGTGGCATGGGCGTGCTGCGGCTTCCGCTCGTCGGAGGCGCAGCTGCAGGTGGGCTACTAC
AACTACACCTGCCCGGGAGCCGAGAGCCTCATCGAGACCATCGTCCACGCCGCCGTCCGCAAGGACGCCGGCAACGGGCCAGGGCTCATCCGCCTCTTCTTCCACGACTGCTTCGTCAGG
GGCTGCGACGCGTCGGTGCTGCTGGACGACCCCACGGGCACCCCGGGCAACGCGACGGTGGAGAAGACCGCGCCGCCCAACTTCCCCAGCCTCCGTGGCTTCGCCGTCATCAACCGCGCC
AAGCGCGTGGTGGAGCGCCGCTGCCCCAGGACCGTCTCCTGCGCCGACATCGTCGCCTTCGCGGCCCGCGACGCGGCCCGCATCATGGGCGGCATCAGGTTCGCCATGCCCTCCGGCCGC
CTCGACGGCCGCGTCTCCAGCGCCTCCGAGGCCATCGCCAACCTTCCGCCGGCCTCCTTCAACCTCACCCAGCTCGTCGCCCGCTTCGCGTCCAAGAACCTCACCGCCGCCGACGTGGTC
ACCCTCTCCGGCGCCCACTCCATCGGCCGCTCCCACTGCTCCTCCTTCTCCGGCCGCCTGTACCCGCAGCTCGACCCCGCCATGAACGCCACGCTCGGCGCCGCGCTCCGGGGTAGGTGC
CCCGCCGCCACGGGCCGGCGCGACCGCGTCGTGGACCTCGACTTCAAGACGCCGCTGCAGCTGGACAACCAGTACTACCGGAACGTGCAGACCCACGAGGTGGTGTTCACGTCGGACCAG
TCGCTCGTCGACCGCAACGACACGGCGGCGCTCGTCGCGCTCTACGCCGCCAACCGGAAGCTCTGGTCGCAGCAGTTCGCCGCCGCCATGGTGAAGATGGGCAGCATCGAGGTGCTCACC
GGGCCGCCAGGGGAGGTCAGGCTCAAGTGCAACAAGGTCAACTAA

Retrieve as FASTA