Entry information : SiPrx96 (Si022656m)
Entry ID 9587
Creation 2011-07-03 (Qiang Li)
Last sequence changes 2011-12-07 (Qiang Li)
Sequence status complete
Reviewer Christophe Dunand
Last annotation changes 2016-01-08 (Christophe Dunand)
Peroxidase information: SiPrx96 (Si022656m)
Name (synonym) SiPrx96 (Si022656m)
Class Class III peroxidase    [Orthogroup: Prx004]
Taxonomy Eukaryota Viridiplantae Streptophyta Monocotyledons Poaceae Setaria
Organism Setaria italica    [TaxId: 4555 ]
Cellular localisation N/D
Tissue type N/D
Inducer N/D
Repressor N/D
Best BLASTp hits
Perox score E-value SiPrx96
start..stop
S start..stop
SbPrx126 581 0 23..326 23..326
OsPrx74 568 0 1..326 1..326
ZmPrx88 564 0 23..326 20..323
TaPrx24-1B 548 0 1..326 1..326
Gene structure Fichier Exons
ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize ExonStart..EndSize
N° 1 14385297..14385503 207 N° 2 14385026..14385214 189 N° 3 14384342..14384923 582  
complement(join(14384342..14384923,14385026..14385214,14385297..14385503))


exon

Literature and cross-references SiPrx96 (Si022656m)
DNA ref. Phytozome 12:   scaffold_3 (14385503..14384342)
Protein sequence: SiPrx96 (Si022656m)
Sequence Properties
first value : protein
second value (mature protein)
Length (aa):   %s   326 (305)
PWM (Da):   %s   35288.61 (33317.5) Transmb domain:   %s   i7-24o
PI (pH):   %s   6.71 (6.51) Peptide Signal:   %s   cut: 22 range:22-326
Sequence
Send to BLAST
Send to Peroxiscan
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
MASRAAVVVLLLSAFAAAAASAQLDEKFYSQSCPSVEDVVRKEMVRALSAAPSLAGPLLRMHFHDCFVRGCDGSVLLDSTANTTAEKDAKPNLTLRGFGFIERVKAAVEKACPDTVSCADVLALMARDAVWLSKGPFWAVPLGRRDGRVSISNETDQLPPPTGNFTELTQIFATKNLDAKDLVVLSAGHTLGTSHCFSFSDRLYNFTGMDNAHDTDPTLDPMYMARLRGKCPSLDDNTTLVEMDPGSFKTFDLSYFGHVAKRRGLFHSDGALLTDPFTRAYVLRHATGAYREEFFADFAASMVKMGSVEVLTGSQGEIRKKCSVVN

Retrieve as FASTA  
Remarks Complete sequence from genomic (introns 1 and 2).
DNA
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCCAGGGCGGCCGTCGTGGTCCTGCTGCTCTCGGCGTTCGCGGCGGCGGCGGCGTCGGCGCAGCTGGACGAGAAGTTCTACAGCCAGTCGTGCCCCAGCGTGGAGGACGTCGTC
CGGAAGGAGATGGTGCGCGCGCTCTCCGCCGCACCCAGCCTCGCCGGGCCGCTCCTCCGCATGCACTTCCACGACTGCTTCGTCAGG
GTACGTGCGCTGCGTTGCATTGTTCATGTGCTC
TGTGCATCTCGGCTTGCATTGGATTGCTCACCTCCGTTGCTGCATGCAGGGGTGCGACGGCTCGGTGCTCCTGGACTCCACCGCGAACACCACGGCGGAGAAGGACGCGAAGCCGAACCT
GACGCTGCGCGGCTTCGGCTTCATCGAGAGGGTCAAGGCCGCCGTGGAGAAGGCGTGCCCGGACACCGTCTCCTGCGCCGACGTGCTGGCACTCATGGCCAGGGACGCCGTGTGGCTG
GT
GAGCACTCGCCACACTGTTCCAAGCTTACAATGCGTGTATTCTTCTCCAAGTAGAAATTCTCAACACAAGTTCGCTGATTCTTTCACGTACCACGCGCAGAGCAAGGGCCCATTCTGGGC
GGTGCCCCTCGGCCGGCGCGACGGCAGGGTGTCCATCTCCAACGAGACCGACCAGCTTCCGCCTCCCACGGGCAACTTCACGGAGCTGACCCAGATCTTCGCGACCAAGAACCTCGACGC
CAAGGACCTCGTCGTCCTCTCCGCCGGCCACACCCTCGGCACCTCCCACTGCTTCTCCTTCTCGGACCGGCTCTACAACTTCACTGGCATGGACAACGCCCACGACACCGACCCGACGCT
GGACCCCATGTACATGGCGCGCCTCCGCGGCAAGTGCCCGAGCCTCGACGACAACACGACGCTGGTGGAGATGGACCCCGGCAGCTTCAAGACCTTCGACCTGAGCTACTTCGGCCACGT
GGCCAAGCGCAGGGGCCTCTTCCACTCCGACGGCGCGCTGCTCACCGACCCCTTCACCCGCGCCTACGTGCTCCGCCACGCCACCGGCGCCTACAGGGAGGAGTTCTTCGCCGACTTCGC
CGCGTCCATGGTCAAGATGGGCTCCGTCGAGGTGCTCACCGGCAGCCAGGGCGAGATCAGGAAGAAGTGCAGCGTCGTGAAT

Retrieve as FASTA  
CDS
Send to BLAST
.........1.........2.........3.........4.........5.........6.........7.........8.........9.........0.........1.........2
ATGGCGTCCAGGGCGGCCGTCGTGGTCCTGCTGCTCTCGGCGTTCGCGGCGGCGGCGGCGTCGGCGCAGCTGGACGAGAAGTTCTACAGCCAGTCGTGCCCCAGCGTGGAGGACGTCGTC
CGGAAGGAGATGGTGCGCGCGCTCTCCGCCGCACCCAGCCTCGCCGGGCCGCTCCTCCGCATGCACTTCCACGACTGCTTCGTCAGG
GGGTGCGACGGCTCGGTGCTCCTGGACTCCACC
GCGAACACCACGGCGGAGAAGGACGCGAAGCCGAACCTGACGCTGCGCGGCTTCGGCTTCATCGAGAGGGTCAAGGCCGCCGTGGAGAAGGCGTGCCCGGACACCGTCTCCTGCGCCGAC
GTGCTGGCACTCATGGCCAGGGACGCCGTGTGGCTG
AGCAAGGGCCCATTCTGGGCGGTGCCCCTCGGCCGGCGCGACGGCAGGGTGTCCATCTCCAACGAGACCGACCAGCTTCCGCCT
CCCACGGGCAACTTCACGGAGCTGACCCAGATCTTCGCGACCAAGAACCTCGACGCCAAGGACCTCGTCGTCCTCTCCGCCGGCCACACCCTCGGCACCTCCCACTGCTTCTCCTTCTCG
GACCGGCTCTACAACTTCACTGGCATGGACAACGCCCACGACACCGACCCGACGCTGGACCCCATGTACATGGCGCGCCTCCGCGGCAAGTGCCCGAGCCTCGACGACAACACGACGCTG
GTGGAGATGGACCCCGGCAGCTTCAAGACCTTCGACCTGAGCTACTTCGGCCACGTGGCCAAGCGCAGGGGCCTCTTCCACTCCGACGGCGCGCTGCTCACCGACCCCTTCACCCGCGCC
TACGTGCTCCGCCACGCCACCGGCGCCTACAGGGAGGAGTTCTTCGCCGACTTCGCCGCGTCCATGGTCAAGATGGGCTCCGTCGAGGTGCTCACCGGCAGCCAGGGCGAGATCAGGAAG
AAGTGCAGCGTCGTGAAT

Retrieve as FASTA